Разное

Улитка 2108 на ниву: Установка вентилятора отопителя от ВАЗ 2108 на Ниву

Установка печки ВАЗ 2108 на Ниву: схема, видеоинструкция

Переделка штатной печки на Ниве поможет вам предотвратить множество проблем в будущем, когда начнутся устойчивые морозы. Главной проблемой отопительной системы этого автомобиля является то, что зимой салон практически не отапливается. Самостоятельная установка деталей печки ВАЗ-2108 на Ниву поможет персонализировать этот агрегат и сделать его работу более эффективным. Опытные автолюбители рекомендуют ставить на Ниву 4×4 лишь часть запасных частей от печки, чтобы не проводить более глобальные работы.

Читайте также:Самостоятельная замена крана печки ВАЗ-2109 высокая и низкая панель

Доработка печки: инструкция

Чтобы доработанный агрегат работал более эффективно, необходимо установить на него качественные запасные части. Делается это следующим образом:

Читайте также: Как делается замена радиатора печки Лада Калина

  1. Под новый отопитель от ВАЗ-2108 вырезается посадочное место. Делайте это аккуратно, чтобы оно проваливалось или находилось выше воздуховодов. При этом двигатель должен располагаться так, чтобы он не упирался в капот, то есть как можно ниже. В противном случае, вентилятор его выйдет из строя очень быстро.
  2. Через выходное отверстие в воздуховоде плавно выведите питание двигателя.
  3. Уплотните места крепления отопителя герметиком. Не пропустите ни одного крепежа, иначе во время работы двигателя от вибрации питание двигателя будет нарушено.
  4. Две пластины из нержавеющей стали вырежьте под размеры сопла и верхнего проема. Несколько раз отмерьте, прежде чем разрезать сталь.
  5. Кран(заслонку) снимите при помощи гаечного ключа и отвертки. Делайте работу аккуратно, чтобы вам не пришлось покупать новую печку.
  6. Завершите работу установкой новых воздуховодов и сборкой системы.

Не стоит устанавливать дополнительный отопительный агрегат на вашу Ниву, она не даст много тепла, но повысить нагрузку на двигатель. Рекомендуется после завершения монтажа проверить деталь на нескольких режимах. Если нет вибрации и шума, то можно пользоваться обновленной печкой без ограничений.

Читайте также:Как правильно разобрать печку на ВАЗ-2107

Рекомендации специалистов по доработке печки деталями ВАЗ

Установку деталей от ВАЗ стоит производить при соблюдении правил:

  1. Необходимо посадочное гнездо под новую деталь сделать на 2 сантиметра больше, чтобы снизить вибрационную нагрузку.
  2. Установка крана должна производиться с учетом специфики отеплителя ВАЗ. В этом случае проблем, с этой деталью будет меньше.

Если во время демонтажа старой печки вы заметили, что она имеет значительный износ, то лучше всего заменить агрегат полностью. У целой с виду «улитки» необходимо менять только двигатель. Разбирайте корпус аккуратно, чтобы не повредить его. Замена мотора отопителя – наиболее приемлемая по затратам времени процедура. Вам не нужно будет подгонять корпус печки под размеры «улитки».

Понравилась статья? Поделиться с друзьями:

Нива печка 2108 | VAZ 21213 VAZ 2131 ВАЗ 21214 тихая печка Нива с вентилятором 2108

 

Обновлено:

Нива-печка салонный фильтр и мотор вентилятора 2108 легко установить своими руками в автомобиль Нива ВАЗ 2121 21213 21214 2131 LADA 4×4 URBAN 21215, 21219, Нива-Бронто, 2129, 21310, Нива-пикап, 21214-М, ЛАДА 4х4 УРБАН.

Добро пожаловать на наш сайт НИВА ПЕЧКА. Если вы здесь, значит у вас есть автомобиль Нива . И значит у вас есть вопросы по вентиляции и обогреву в салоне Нивы. Если вы еще не переоборудовали штатный отопитель в Ниве, то наш сайт поможет вам в этом деле. Когда-то любой владелец Нивы задается вопросом — что делать со штаным вентилятором отопителя? Вентилятор отопителя шумит, у него низкая производительность, к нему неудобно добираться для его ремонта, всего две скорости, в мороз из-за плохой вентиляции окна в салоне Нивы затягивает инеем. И эти недостатки присутствуют на любой модели Нива 2121 21213 21214 2129 2131. В том числе и на современных ЛАДА 4х4 УРБАН, LADA 4×4 URBAN. Причем независимо от года выпуска и варианта исполнения, будь то карбюраторная Нива или инжекторная Нива.
Для решения этого вопроса предлагается установить вентилятор отопителя 2108 в печку Нива. В принципе установка улитки зубильного вентилятора отопителя в Ниву посильна любому владельцу русского джипа. Для этого в сети есть все чертежи воздухозаборника для установки вентилятора 2108 в Ниву. Так же потребуется пара недель времени, металл, угловая шлифмашинка, сварка, сколько-то потраченных нервов, потому-что с первого раза размер, как всегда, будет не тот. Необходимо также позаботится о месте крепления резистора отопителя, изготовить жгут для подключения вентилятора 2108, укомплектовать всеми болтиками, переключателями и т.д. и т.п. Для любителей творить своими руками это доставит немало удовольствия, особенно, когда новая Нива печка заработает с вентилятором от 2108!

 

Однако не у всех есть время для таких экспериментов, работа и домашние заботы могут запросто отбить желание переделывать печку в Ниве. Несмотря на кажущуюся дешевизну самостоятельной переделки вентилятора отопителя в Ниве, личное время потраченное на переделку печки может свести на нет всю экономию. Но самое обидное, когда начав переделку печки в Ниве, по разным причинам (кому-то надо просить сварку, кому-то искать электрика, чтоб подключить вентилятор) дело затягивается, деньги потрачены, печка в Ниве еще не переделана, а зима приходит неожиданно!

В нашей команде у всех есть автомобиль Нива, и мы знаем эту проблему непонаслышке. Поэтому мы предлагаем для переделки печки на Ниве различные комплекты, выверенные по размеру и готовые для установки как на карбюраторные так и на инжекторные Нивы. Комплекты Нива печка для установки вентилятора 2108 в Ниву самые разнообразные по составу. От самого полного комплекта (окрашенный корпус воздухозаборника для крепления вентилятора 2108, реостат, переключатель скорости, ручки, болты, уплотнители, улитка 2108, усиленный электрический жгут для подключения в штатную проводку без ее повреждения) до любого элемента по отдельности. Вы сами можете выбрать какие элементы у вас уже есть, а какие вам нужно приобрести. А съэкономленное время это по сути съэкономленные деньги. И поверьте, какой-бы способ переделки печки на вашей Ниве вы бы ни выбрали, когда вы завершите переделку, готовый результат доставит вам только положительные эмоции! И вы полюбите свою Ниву еще больше.

Успехов вам, с уважением команда сайта nivapechka.com.


Владельцам автомобиля Нива посвящается!

Легендарный советский внедорожник ВАЗ 2121 Нива, а теперь и российский ЛАДА 4х4 любим многими поколениями россиян. Нива пользуется заслуженной популярностью и за рубежом, за свою неприхотливость и непревзойдённые вездеходные качества. Я также являюсь поклонником автомобиля Нива. Много лет эксплуатирую ВАЗ 2131 Нива. Но как в далёком в 1977 году, так и в настоящем 2013 году автомобили Нива имеют моторчик печки с лопастной конструкцией, который шумит, визжит и не справляется с вентиляцией салона. читать дальше…  
Что до сих пор является ложкой дёгтя в автомобиле Нива. Это заставило меня взяться за поиск решения проблемы. Так как я живу в Сибири и 6 месяцев в году у нас зима и регулярно бывают морозы -300С и -400С, со штатным вентилятором окна регулярно приходится отскрёбывать от инея. А если едешь в -300С по трассе, ещё и лобовик затягивает. Отказываться от автомобиля Нива из-за плохой печки не было желания. Стал искать решение вопроса. Первое, что пришло на ум использовать вентилятор печки ВАЗ 2108 (высокая производительность, тихая работа, доступная цена, достаточно высокий ресурс). Различные эксперименты с установкой вентилятора укрепили мысль установить его в подкапотном пространстве. Для этого потребовалась серьёзная модификация штатного воздухозаборника. Путём подрезания и перепаивания воздухозаборника была получена необходимая конструкция. Практические испытания показали её высокую эффективность. Как оказалось, в своих изысканиях был не одинок и на просторах интернета я натолкнулся на аналогичную конструкцию уважаемого Cмогилa. Его конструкция была похожа на мою, но отличалась тем, что состояла из двух частей. Благодаря этим идеям я изготовил свою модернизированную печку из металла и из двух частей для своего автомобиля, которой очень доволен. В результате чего она стала практичней и значительно удобней в эксплуатации. А вентиляция салона в Ниве стала выше всяких похвал. Рекомендую такую печку всем Ниваводам.

 

Декабрь 2021

Поздравляем с наступающим Новым 2022 Годом!

 
Поздравляем всех с наступающим Новым 2022 годом! Желаем всем здоровья, счастья и Новогоднего настроения! Пусть все плохое (и короновирус) останется в прошлом, а в новом будет только хорошее! Не болейте, берегите себя и своих близких! С наилучшими пожеланиями команда сайта nivapechka.com Декабрь 2020

Поздравляем с наступающим Новым 2021 Годом!

 
Поздравляем всех с наступающим Новым 2021 годом! Желаем всем здоровья, счастья и Новогоднего настроения! Пусть все плохое останется в этом году, а в новом будет только хорошее! Берегите себя и своих близких! С наилучшими пожеланиями команда сайта nivapechka.com Ноябрь 2020

Надежда на вакцину от SARS-CoV-2!

 
Сразу несколько фармацевтических гигантов сообщили о своих промежуточных успехах в создании вакцины от COVID-19. Так же они сообщают о возможном скором запуске их промышленного производства. Это очень хорошие и обнадеживающие новости! С наилучшими пожеланиями команда сайта nivapechka.com Январь 2020 Январь 2019 29.11.2018 26.06.2018 29.12.2017

C наступающим Новым 2018 Годом!!!

 
Поздравляем с наступающим Новым годом наших клиентов, партнеров и сотрудников! Мы высоко ценим оказанное нам доверие и искренне желаем в наступающем году, стабильности, новых побед, успехов и благополучия. С наилучшими пожеланиями nivapechka.com
12.04.2017 12.04.2017

Наша легендарная «Нива» отмечает юбилей!

 
Прошло 40 лет с тех пор как с Волжского автомобильного завода вышла первая серийная «Нива». Автомобиль завоевал уважение поклонников со всех континентов и стал родоначальником класса SUV (Sport Utility Vehicle). По прошествии 40 лет с момента выхода первого серийного автомобиля «Нива» изменилась несильно. В девяностых годах руководство умудрились передать имя «НИВА» совместному предприятию с General Motors. Новое имя «Lada 4×4» не популярно, и народ называет автомобиль, как и прежде «НИВА»!. Автомобиль превратился в легенду, и лишить его имени невозможно. Приводя цитату из Top Gear, где телеведущий и журналист Джеймс Мэй оценивает нашу машину: «„Нива“, запущенная в производство в 1977 году, была первой „Ладой“, не копирующей итальянские седаны. В то время как всё, что находилось под капотом, принадлежало Fiat, система управления и корпус были трудами великолепной работы „Лады“. Она получила свою репутацию за живучесть, достигла кое-каких успехов во внедорожных гонках и заработала престиж у землевладельцев и у других людей без чувства иронии. И даже сейчас, несмотря на первоначальный скептицизм, она способна унизить более крупных и современных конкурентов на бездорожье». Нынешний интерес программы Top Gear к 40-летней модели «Нива» неслучаен. В Великобритании перестал продаваться архаичный Land Rover Defender. И жителям сельских районов русская простая и надежная «Нива» видится достойной альтернативой их Defender-у. Потребность в простой и неприхотливой конструкции, ремонт которой доступен и в гараже, и в поле, до сих пор велика. Эпоха «Нивы» продолжается — поздравляем с ЮБИЛЕЕМ!

28.12.2016

Поздравляем С Новым 2017 Годом!

 
Поздравляем всех с Новым 2017 годом! Мы желаем всем Новогоднего настроения, и пусть в наступающем Новом Году сбудутся все ваши мечты! С наилучшими пожеланиями команда сайта nivapechka.com
Расписание работы на Новогодние праздники. В магазинах на ул.Трикотажной и на авторынке «Столица» ул.Петухова 51Г праздничные дни с 01.января 2017 года по 04.января 2017 года включительно. 05-06 января рабочие дни, 07-08 января праздничные дни. С 09 января 2017 года работа по обычному расписанию. Отправка заказов в регионы в новом 2017 году возобновится с 14.01.2017 года.
31.08.2016 26.02.2016

Профилактика гибочного пресса с 02 марта по 15 марта 2016г.

 
В период с 02 марта по 15 марта у нас будут производиться работы по профилактике и перенастройке гибочного пресса. В связи с этим заказы, оформленные (и оплаченные) в период с 02.03.2016г по 15.03.2016г, будут отправлены в срок до 19 марта 2016 года. Далее оформление и отправка заказов будет производиться в обычном графике. Заказы, оформленные (и оплаченные) до 02 марта 2016г будут отправлены по обычному расписанию (без задержек). С наилучшими пожеланиями команда сайта nivapechka.com
21.12.2015 21.12.2015

Расписание работы на Новогодние праздники.

 
В магазинах на ул.Трикотажной и на авторынке «Столица» ул.Петухова 51Г праздничные дни с 01.января 2016 года по 11.января 2016 года включительно. С 12 января 2016 года работа по обычному расписанию. Отправка заказов в регионы в этом году до 26.12.2015 года включительно. В новом 2016 году отправка возобновится с 15.01.2016 года. Это связанно с расписанием работы транспортных компаний в Новогодние праздники, а также из-за значительного предпраздничного ажиотажа на Почте России. Поэтому отправка заказов в период с 26.12.2015г по 15.01.2016г производится не будет. Надеемся на ваше понимание.

19.10.2015 12.06.2015

Сайт Нива печка получил обновленный дизайн и доступен на мобильных устройствах.

 
Мы запустили обновленную версию сайта Нива-печка. Теперь пользоваться сайтом Нива-печка удобно и на мобильных устройствах. Как и прежде никакой посторонней рекламы. Только полезная информация касающаяся вентиляции и отопления автомобиля Нива LADA 4×4 URBAN. Как сделать Ниву комфортней и удобней в эксплуатации. Как самостоятельно установить Нива-печка с салонным фильтром в домашнем гараже. И другие вопросы как сделать Ниву лучше. Надеемся вам будет удобно пользоваться нашим сайтом nivapechka.com

15.03.2015

LADA 4×4 URBAN Нива кондиционер и печка с салонным фильтром.

 
Мы адаптировали комплекты Нива-печка «МАКСИ КЛАССИК» и «МАКСИ С САЛОННЫМ ФИЛЬТРОМ» для установки в новые автомобили LADA 4×4 URBAN и Лада 4х4 Урбан! Наличие подробной инструкции по установке позволяет произвести установку Нива-печка даже самостоятельно в домашнем гараже. А бумажный салонный фильтр промышленного производства надежно защитит радиатор отопителя и кондиционера, а так же салон Нивы от пыли и тополиного пуха.

04.01.2015

Изменение цен с 4 января 2015 года.

 
У нас произошло изменение цен на комплекты и комплектующие Нива-печка с 4 января 2015 года по известным причинам. Мы работаем с различными поставщиками: металла, моторов 2108, мелких комплектующих. Однако мы прилагаем все усилия, которые зависят от нас, чтобы эти изменения были минимальными.

05.02.2014

Установка вентилятора от ваз 2108 на ниву

Переделка печки на Ниве 21213 своими руками необходима при сбое в работе системы отопления автомобиля. Медлить с этим не стоит, ведь неравномерная термическая регуляция приводит к запотевшим стеклам или обледенению. В любом из указанных случаев ухудшается обзор происходящего на дороге. Неисправность вызывает износ отдельных элементов устройства или заводской брак.

Диагностирование неисправности

Потребуется переделка печки, поставляемой в штатной комплектации, в профилактических целях. Много времени процедура не отнимет, зато предотвратит множество проблем в будущем. Водительский опыт говорит о том, что первые сильные морозы подкосят «здоровье» устройства. Список основных слабых мест выглядит следующим образом:

  • оптимальный диапазон рабочей температуры модели 2121 от -5 до +10°С;
  • неспособность прогреть воздух в салоне, если за бортом -8°С и ниже;
  • при увеличении мощности обдува не происходит увеличение температуры;
  • при езде на II передаче шум от печки Нивы становится существенным.

Именно поэтому лучше заблаговременно принять необходимые меры. Альтернатив у водителя немного. С одной стороны, все остается на своих местах. Отопительное устройство используется на минимальной мощности. Во время мягких зим подобное еще терпимо, но с приходом настоящих холодов условия станут невыносимы. С другой стороны, несложно потратить несколько часов для исправления ситуации.

Дальнейшее развитие событий идет следующим образом. Если отопление в машине работает на ½ мощности, можно ограничиться незначительным ремонтом. Главное — убедиться в отсутствии шумов и посторонних стуков, иначе Нива 21213 должна немедленно отправиться на технический осмотр.

Наличие неприятного звукового сопровождения говорит о необходимости замены устройства. В специализированной торговой сети представлены готовые варианты отопительных механизмов на Ниву. При желании таковой собирается самостоятельно.

Второй вариант считается более предпочтительным. При самостоятельной сборке есть возможность в буквальном смысле персонализировать печку. Для выполнения работы своими руками понадобится посетить специализированный магазин или рынок для покупки запчастей.

При покупке выбираются оригинальные детали или аналоги. Главное, чтобы они имели сертификат качества. В противном случае поставить их нельзя. Нелишним будет переписать технические данные транспортного средства, чтобы не превысить рекомендованные заводом-изготовителем параметры.

Технические тонкости процедуры

Эффективность работы новой отопительной системы на Ниве определит не стоимость купленных деталей, а их качество. Для работы понадобятся следующие элементы: автомобильный резистор, отопитель восьмерки и «улитка». Ошибочно полагать, что подойдут только «родные» запчасти для ремонта отопительного устройства. Главное требование — техническая совместимость.

Если возникают сомнения, ясность внесет чертеж системы отопления. Дальнейший порядок действий выглядит следующим образом:

    Вырезать новое посадочное отверстие. Делается это аккуратно, ведь от качества подготовительного процесса зависит надежность эксплуатации системы обогрева. Рекомендуется поместить двигатель в воздуховод как можно ниже, иначе устройство будет упираться в капот. Допускать подобного не стоит, иначе вентилятор печки долго не продержится.

Проверяется отопительная система нового образца пробным включением. Рекомендуется плавно переключать режимы. На каждом из них устройство должно находится не менее 5-7 минут. Задача водителя — убедиться в том, что работа системы не сопровождается посторонними шумами и вибрацией.

Оригинальные детали vs аналоги: практические советы

Как уже было сказано ранее, подобный выбор не отражается на качестве работы отопительной системы. При этом автослесари делают несколько оговорок. Тем, кто планирует использовать печки ВАЗ, нелишним будет проверить систему питания. У некоторых модификаций она отличается. Именно поэтому все действия согласуются с чертежами.

Допускается использование отопителя ВАЗ 2108 при условии соблюдения двух рекомендаций. Во-первых, посадочное гнездо на 1-2 см больше размера устройства. Дополнительная площадь снизит вибрационное воздействие. Во-вторых, переключатель устанавливается с учетом специфики отопительной системы ВАЗ. Меньше придется повозиться, когда необходима незначительная доработка системы.

Вентиляционная система обновляется за 1-2 часа в зависимости от степени износа движка.

Если установленная заводом-изготовителем «улитка» не имеет следов физического износа, необходимо только заменить сам «движок» отопителя.

Хуже, если заводская комплектация модели Шевроле имеет производственные дефекты. Рекомендуется полная замена устройства. Это сэкономит время.

Работа системы отопления определяет комфортность и безопасность езды. Водитель постоянно отслеживает эффективность работы системы. В случае появления посторонних шумов необходимо срочно провести технический осмотр.

Печка в Ниве откровенно говоря плохая! Одной из ее самых важных проблем является собственно сам вентилятор, которые установлен под радиатором, да к тому же еще и вертикально. Проходя через него горячий воздух сильно нагревает его и вся смазка постепенно стекает с ротора. Как следствие моторчик начинает визжать! Наверное все знают эту проблему! Ну а производительность там вообще на нуле.

Ставим «улитку» от ВАЗ-2108 и получаем увеличение производительности, тищину, и при желании три скорости управления.

Идея не нова, я позаимствовал ее на других сайтах. Только каждый делает по своему — вот как сделал я.

При всем этом, после переделки мотора печки вообще не слышно так как сам мотор теперь стоит в подкапотном пространстве!

Разбираем полностью весь отопитель!

При желании иметь три скорости — в нижнюю чать корпуса, со стороны водителя, врезаем резистор печки от ВАЗ-2108/М2141

Все стыки корпуса, а особенно место установки радиатора ваз 2121, проклеиваем резиновым уплотнителем (есть в любом строительном магазине)

Собираем нижнюю часть, двигатель ваз 2131 с вентилятором от туда просто выкидываем! Он нам больше не нужен!

Разбираем верхнюю часть отопителя, вынимаем решетку из воздухозаборника нива 2121.

И аккуратно с минимальными зазорами вырезаем место под «улитку» от ВАЗ-2108. Устанавливаем ее так, как позакано на фото (вид снизу)

Оставшуюся полость запоняем монтажной пеной! Затем, после застывания, срезаем ее вровень с нижней частью корпуса воздухозаборника.

Вот такой вот воздухозаборник нива 2131 должен получиться!

Одеваем уплотнитель и устанавливаем под капот!

Информационно — познавательный портал для автомобилистов

Печка в Ниве откровенно говоря плохая! Одной из ее самых важных проблем является сам вентилятор, который зачастую издает визжащие звуки да и производительность его довольно низка…

Основной причиной неприятных звуков вентилятора является тот факт, что он установлен под радиатором, да еще и в вертикальном положении. Проходя через него, уже нагретый воздух, сильно нагревает двигатель самого вентилятора и вся смазка постепенно стекает с ротора. Как следствие моторчик начинает визжать, так как втулки со временем остаются почти без смазки. Думаю многие знакомы с этой проблемой!

Но проблема решаема!
Ставим «улитку» от ВАЗ-2108 и получаем увеличение производительности, тишину, и при желании три скорости управления.
Сама идея в общем то не нова, я позаимствовал ее так же на одном из форумов. Только каждый делает по своему. Вот как сделал я…

Одно из основных преимуществ после переделки, мотора печки вообще не слышно, так как сам мотор теперь стоит в подкапотном пространстве!

Итак, процесс:
Снимаем с машины и разбираем отопитель…

При желании иметь три скорости, в нижнюю часть корпуса, со стороны водителя, врезаем резистор печки от ВАЗ-2108/М2141

Все стыки корпуса, а особенно место установки радиатора, проклеиваем резиновым уплотнителем (его можно купить в любом строительном магазине)

Собираем нижнюю часть. Сам вентилятор туда не ставим, просто выкидываем, он нам больше не нужен!

Разбираем верхнюю часть отопителя, вынимаем решетку из воздухозаборника…

И аккуратно с минимальными зазорами вырезаем место под «улитку» от ВАЗ-2108. Устанавливаем ее так, как показано на фото ниже (вид изнутри)

Оставшуюся полость, так же аккуратно, заполняем монтажной пеной, заклеив все «ненужные» места малярным скотчем, что бы избежать склеивания самого вентилятора!
Затем, после застывания, срезаем ее вровень с нижней частью корпуса воздухозаборника.

Вот такой воздухозаборник должен получиться в итоге:

Одеваем на него уплотнитель и устанавливаем под капот на своё место…

Как видите усилий требуется не так много и результат того стоит! Производительность значительно увеличивается и салон быстрее прогревается.

Переделка печки ваз 2121 — ProDemio.ru

Меня всегда удивляло, что вполне толерантная печка не понимает где и не стоит. Короче замороженный. Я всегда хотел каким-то образом направить поток. Решение неожиданно было найдено в магазине сантехники — 2 уголка 32мм * 45 * + 2 переходника majety 32> 40.

Узел завязки резинкой сняли с углов, манжеты разрезали примерно пополам по длине. В боковых стенках корпуса печи проделали два отверстия одним диаметром

40 мм вставляем манжеты, а в манжеты наши уголки, толстой стороной. Также с крышки нужно снять ручку и ребра по бокам. Саму крышку необходимо надежно закрепить саморезами. Все операции удобно делать дома, в теплом месте, на снятом футляре, а я делал это в машине.

В результате мы получаем поток горячего воздуха прямо к ногам.

Салонный фильтр печки Нива и мотор вентилятора 2108 легко устанавливаются своими руками в автомобиль Нива ВАЗ 2121 21213 21214 2131 LADA 4×4 URBAN 21215, 21219, Нива-Бронто, 2129, 21310, Нива-пикап, 21214- М, LADA 4×4 URBAN.

Добро пожаловать на наш сайт НИВА ПЕЧКА. Если вы здесь, значит, у вас есть Нива. А это значит, что у вас есть вопросы по вентиляции и отоплению в салоне Нивы. Если вы еще не переделали штатный отопитель на Ниву, наш сайт поможет вам в этом вопросе. Давным-давно любой владелец Нивы задается вопросом: а что делать с вентилятором обогрева брюк? Вентилятор отопления шумный, имеет плохую работу, неудобно дотягиваться до ремонта, всего две скорости, когда холодно из-за плохой вентиляции, окна салона Нивы на морозе выдавливаются. И эти недостатки присутствуют на любой модели Нивы 2121 21213 21214 2129 2131. В том числе и на современных LADA 4×4 URBAN, LADA 4×4 URBAN. Причем вне зависимости от года выпуска и версии, карбюраторная это Нива или инжекторная Нива.
Для решения этой проблемы предлагается установить в печку Нива вентилятор отопителя 2108. В принципе, установить на Ниву долото-улитку вентилятора отопителя под силу любому владельцу российского джипа. Для этого в сети есть все конструкции воздухозаборника для установки вентилятора 2108 на Ниве. Также потребуется пара недель времени, металл, угловая шлифовальная машина, сварные швы, немного потраченных нервов, потому что в первый раз размеры, как всегда, будут уже не те. Также необходимо позаботиться о месте фиксации сопротивления ТЭНа, сделать разводку для подключения вентилятора 2108 в комплекте со всеми болтами, переключателями и так далее и т.д. Любителям творить своими руками это доставит массу удовольствия, особенно когда новая печка Нива начинает работать с вентилятором 2108!

Однако не у всех есть время на подобные эксперименты, работа и домашние дела легко могут отбить желание переделать печку в Ниве. Несмотря на кажущуюся дешевизну самостоятельной замены вентилятора отопителя на Ниве, личное время, потраченное на модификацию печки, может свести на нет всю экономию. Но самое обидное, когда после запуска доработки печки в Ниве по разным причинам (кто-то просит пайку, кто-то должен искать электрика для подключения вентилятора) дело затягивается, деньги прошло, печка на Ниве еще не переделана, а зима приходит неожиданно!

У всех в команде есть машина «Нива», и мы не понаслышке знаем эту проблему. Поэтому мы предлагаем различные комплекты для доработки печки на Ниве, откалиброванные по размеру и готовые к установке как с карбюратором, так и с впрыском Нивы. Комплекты печки Нива для установки вентилятора 2108 на Ниву очень разные по составу. От самой полной комплектации (окрашенный корпус воздухозаборника для крепления вентилятора 2108, реостат, переключатель скоростей, ручки, болты, прокладки, гайка 2108, усиленная электропроводка для подключения к штатной проводке без ее повреждения) до любого элемента отдельно. Вы сами можете выбрать, какие предметы у вас уже есть, а какие нужно купить. А сэкономленное время — это, по сути, сэкономленные деньги. И поверьте, какой бы способ доработки печки на своей Ниве вы ни выбрали, по завершении доработки конечный результат доставит вам только положительные эмоции! И еще больше полюбите свою Ниву.

Вентилятор печки для ВАЗ 2121

Салон ВАЗ 2121 Нива никогда не назывался жарким, особенно в лютые морозы. Многие борются с этой проблемой, используя различные жидкости для полной защиты всей системы отопления, в то время как спирт и глицерин используются в жидкости для достижения наилучшего эффекта. Это необходимо потому, что некоторые детали автомобиля Нива очень плохо установлены и сконструированы. Любые трещины или зазоры необходимо заделать герметиком или пеной. Салон автомобиля НИВА должен в первую очередь быть теплым и не пропускать влагу, ведь ВАЗ 2121 — машина для экстремальных условий.

Нужно знать, как расположены форсунки, откуда воздух поступает на лобовое стекло. Некоторые автолюбители затыкают прямые воздуховоды, чтобы надуть боковые окна. С таким вариантом, конечно, можно поспорить, но приклеивать установленный воздуховод к центру всей панели приборов — очень плохая идея. Воздухозаборник, установленный в передней части автомобиля, занимает лишь 2/3 решетки на самом капоте. В этом случае воздушный поток делится на две части.

Только 1/3 потока проходит в меньшую часть, если есть небольшое сопротивление воздуха. В итоге вам нужно приклеить всего 1/3 решетки и делается это малярным скотчем. По возможности лучше заменить стандартный вентилятор с латунными подшипниками на вентилятор с шариковыми подшипниками. Такая вторичная работа не даст сильного эффекта для улучшения теплового потока, но уровень шума все равно снизится. Также необходимо внимательно осмотреть всю систему подачи охлаждающей жидкости. Иногда встречаются небольшие краны с небольшим проходным сечением. В радиаторе образуются осадки некачественной охлаждающей жидкости и в результате образуются воздушные карманы. Также обязательно проверьте термостат.

Стандартная изоляция в автомобиле не впечатляет, и многие со временем ее снимут. Вся изоляция может быть переделана на высоком уровне. Но вернемся к теме замены вентилятора на ВАЗ 2121. Для начала нужно отключить массу аккумулятора. Сначала нужно снять панель, фиксирующую магнитолу, затем нужно открутить гайку, фиксирующую переключатель направления и реле сигнализации. Затем снимите со штифта провод вентилятора отрицательного нагревателя. На этой шпильке можно найти еще две негативные нити. Вытаскиваем шток из-под пружинного зажима, который находится с правой стороны кожуха вентилятора. С помощью отвертки осторожно отсоедините пружинные скобы, удерживающие крышку вентилятора. Снимаем кожух, кожух привода и сам вентилятор. Также необходимо отсоединить все провода вентилятора от дополнительного резистора, после чего вынимаем вентилятор из кожуха. Аккуратно снимаем резиновые накладки электродвигателя и предохранительную шайбу сбоку. Снимаем вентилятор вентилятора и на этом этапе процесс снятия вентилятора отопителя на ВАЗ 2121 можно считать завершенным. Соберите и установите вентилятор в обратном порядке. Также многие рекомендуют изменить дополнительное сопротивление вентилятора. Для этого снова отсоедините «минус» аккумулятора, снимите крышку направления вентилятора, отсоедините кабельные наконечники от выводов дополнительного резистора, снимите две пружинные шайбы, выньте резистор и замените его.

Переделка печки на ниве 21213 своими руками

Переделка печки на Ниве 21213 своими руками необходима при неисправности системы отопления автомобиля. С этим не сомневайтесь, потому что неравномерное терморегулирование приводит к запотеванию стекла или льда. В каждом из этих случаев ухудшается видимость происходящего на дороге. Неисправность вызывает износ отдельных элементов устройства или заводской брак.

Диагностирование неисправности

В профилактических целях потребуется переделать стандартную печь. Процедура не займет много времени, но позволит избежать многих проблем в будущем. Опыт вождения подсказывает, что первые сильные морозы подорвут «здоровье» устройства. Список основных недостатков выглядит следующим образом:

  • оптимальный диапазон рабочих температур модели 2121 от -5 до + 10 ° С;
  • невозможность обогрева воздуха в салоне, если за бортом -8 ° С и ниже;
  • при увеличении мощности обдува температура не повышается;
  • при езде на II передаче шум печки Нивы становится значительным.

Поэтому лучше всего заранее принять необходимые меры. У драйвера есть несколько альтернатив. С одной стороны, все остается на месте. Нагревательный прибор используется на минимальной мощности. В мягкие зимы это еще терпимо, но с наступлением настоящих холодов климатические условия станут невыносимыми. С другой стороны, потратить несколько часов на исправление ситуации несложно.

Дальнейшее развитие событий выглядит следующим образом. Если автомобильный отопитель работает на ½ мощности, можно ограничиться мелким ремонтом. Главное — убедиться в отсутствии посторонних шумов и стуков, иначе Нива 21213 должна сразу же отправляться на технический осмотр.

Наличие неприятного звука говорит о необходимости замены устройства. В специализированной розничной сети представлены готовые варианты механизмов отопления для Нивы. При желании такую ​​собирают самостоятельно.

Второй вариант считается более предпочтительным. При самостоятельной сборке можно буквально настроить печь. Чтобы сделать работу своими руками, вам потребуется посетить специализированный магазин или рынок для покупки запчастей.

При покупке выбираются оригинальные или аналогичные запчасти. Главное, чтобы у них был сертификат качества. В противном случае они не могут быть доставлены. Не лишним будет переписать технические данные транспортного средства, чтобы не превысить рекомендованные производителем параметры.

Технические тонкости процедуры

Эффективность новой системы отопления на «Ниве» будет определяться не стоимостью закупаемых запчастей, а их качеством. Для работы вам потребуются следующие элементы: автомобильный резистор, восьмерка обогреватель и «улитка». Ошибочно полагать, что для ремонта отопительного прибора подходят только «родные» запчасти. Главное требование — техническая совместимость.

В случае сомнений прояснит чертеж системы отопления. Дальнейший порядок действий следующий:

  1. Сделайте новое отверстие. Делается это аккуратно, ведь от качества подготовительного процесса зависит надежность системы отопления. Рекомендуется размещать двигатель как можно ниже в воздуховоде, иначе устройство будет упираться в капот. Этого допускать нельзя, иначе вентилятор печки прослужит недолго.
  2. Осторожно извлеките мощность двигателя из воздуховода. Для этого используется розетка.
  3. Правильная установка предполагает, что двигатель прочно прикреплен к воздуховоду. После этого все без исключения точки крепления заделываются автомобильным герметиком. Настоятельно рекомендуется ничего не упускать. В противном случае из-за вибрационных нагрузок и влияния внешних факторов схема подключения печки будет нарушена.
  4. Возьмите 2 пластины из нержавеющей стали, которые подходят по размеру сопла и верхнего отверстия. Замеры снимаются несколько раз. Педантизм избавит от необходимости дорабатывать.

Система обогрева нового образца проверяется пробным зажиганием. Рекомендуется без проблем переключать режимы. Устройство должно находиться на каждом из них не менее 5-7 минут. Работа водителя — следить за тем, чтобы система не сопровождалась посторонними шумами и вибрациями.

Оригинальные детали vs аналоги: практические советы

Как уже было сказано выше, такой выбор никак не влияет на качество системы отопления. В этом случае автомеханики делают несколько оговорок. Тем, кто намерен использовать печки ВАЗ, будет нелишним проверить систему питания. Для некоторых изменений все по-другому. Именно поэтому все действия соответствуют рисункам.

допускается использование отопителя ВАЗ 2108 при соблюдении двух рекомендаций. Во-первых, посадочная прорезь на 1-2 см больше размера устройства. Дополнительная площадь снизит воздействие вибрации. Во-вторых, переключатель устанавливается с учетом технических характеристик системы отопления ВАЗ. Меньше настроек, когда требуются незначительные изменения системы.

Обновление системы вентиляции занимает 1-2 часа, в зависимости от степени износа двигателя.

Если «улитка», установленная производителем, не показывает признаков физического износа, достаточно заменить «моторчик» самого нагревателя.

хуже, если заводское оборудование модели Шевроле имеет производственные браки. Рекомендуется полная замена устройства. Это сэкономит время.

Работа системы обогрева определяет комфорт и безопасность езды. Водитель постоянно проверяет работоспособность системы. В случае появления посторонних шумов требуется срочный технический осмотр.

Доработка печки Нива 2121, Ваз 2131

2121, 2131

тюнинг

салона

Доработка обдува печки

Тюнинг салона Нива 2121 своими руками, советы по доработке салона, тюнинг салона Нива 2131, ВАЗ 2121. Доработка вентилятора печки Доработка салона, тюнинг салона Нива 2121, Нива 2131, Нива 4х4 тюнинг салона фото, модернизация

Меня всегда удивляло, что вполне толерантная печка не понимает где и не стоит. Короче замороженный. Я всегда хотел каким-то образом направить поток. Решение неожиданно было найдено в магазине сантехники — 2 уголка 32мм * 45 * + 2 переходника majety 32> 40.

Узел завязки резинкой сняли с углов, манжеты разрезали примерно пополам по длине. В боковых стенках корпуса печи проделали два отверстия одним диаметром

40 мм вставляем манжеты, а в манжеты наши уголки, толстой стороной. Также с крышки нужно снять ручку и ребра по бокам. Саму крышку необходимо надежно закрепить саморезами. Все операции удобно делать дома, в теплом месте, на снятом футляре, а я делал это в машине.

В результате мы получаем поток горячего воздуха прямо к ногам.

Тюнинг салона Ваз 2121, Ваз 2131

Дополнительная панель приборов

Установка дополнительной панели приборов Нива 2121, ВАЗ 2131

Установка новой бороды

Новая борода от 21213 на Нива 2121, Ваз 2131

Доработка отопителя салона

Установка дополнительного вентилятора для улучшения внутреннего отопления Нива 2121, ВАЗ 2131

Панель приборов от Газ 3110 вместо стандартной панели

Панель приборов ГАЗ 3110 вместо панели Нива 2121, ВАЗ 2131

Подсветка замка зажигания от ВАЗ-2110

Установка освещения замка зажигания от 2110 на Нива 2121, ВАЗ 2131

Доработка обдува печки

Доработка печки Нива 2121, ВАЗ 2131

Доработка подсветки приборов

Доработка подсветки приборов старого щита Нива 2121, ВАЗ 2131

Установка новой улитки отопителя

Отопительная улитка от 2108 до Нива 2121, ВАЗ 2131

Индикатор расхода топлива

Установка указателя расхода топлива Нива 2121, ВАЗ 2131

Электропривод замка багажника

Установка электропривода замка багажника Нива 2121, ВАЗ 2131

Установка гидрокорректора фар

Гидрокорректор фар Нива 2121, ВАЗ 2131

Стеклоподъемники

Установка электростеклоподъемников Нива 2121, ВАЗ 2131

Тюнинг лада 2121, фотографии тюнинга лада 21213, доработка лада 2131

Тюнинг автомобиля ВАЗ — это повышение заводских характеристик автомобиля. Капитальный ремонт Нивы 2121 — это, прежде всего, установка новых бамперов, защиты картера и лебедки. По желанию владельцев этих внедорожников устанавливаются дополнительные противотуманные фары. В наших разделах описаны инструкции и советы по доработке Нивы 2131 различных агрегатов, например, раздатки и т.д. Сложную настройку судов своими руками может выполнить даже автомобилист. Вы также найдете категории по тюнингу двигателя, тюнингу коробки передач, тюнингу салона и кузова, а также множество фотоотчетов тюнинга ВАЗ 2121. Благодаря интересным решениям тюнинг Нивы доставит вам массу удовольствия и пользы. Если у вас есть фотографии тюнеров, напишите нам.

двигатель, доработка и тюнинг своими руками
трансмиссия, настройка
тормозная система, тюнинг и настройка
подвеска, регулировка и тюнинг своими силами
салон, модернизация
внешний тюнинг кузова
фото тюнинга 2121
тюнинг, фотографии 2131

Улитка отопителя от 2108 на Нива 2121, Ваз 2131

Печка Нива, прямо скажем, очень плохая! Одна из важнейших его проблем — это сам вентилятор, который устанавливается под радиатором, причем еще и вертикально. Проходящий через него горячий воздух сильно нагревает его, и вся смазка постепенно вытекает из ротора. В результате двигатель начинает визжать! Об этой проблеме наверняка знают все! Ну производительность вообще нулевая.

Проблема решаема! Ставим «улитку» от ВАЗ-2108 и получаем прибавку производительности, тишину и при желании три скорости управления. Идея не нова, я позаимствовал ее с других сайтов. За исключением того, что каждый делает это по-своему — я так и сделал.

При этом после переделки двигателя печки его вообще не слышно, так как сам двигатель теперь находится в подкапотном пространстве!

Разбираем полностью весь ТЭН!

Если хотите иметь три скорости: внизу корпуса со стороны водителя вырезаем сопротивление отопителя от ВАЗ-2108 / М2141

Все стыки корпуса, а особенно место установки радиатора ВАЗ 2121 проклеены резиновой прокладкой (есть в любом строительном магазине)

Собираем нижнюю часть, просто выкидываем оттуда двигатель ВАЗ 2131 с вентилятором! Он нам больше не нужен!

Разбираем верхнюю часть отопителя, снимаем решетку с воздухозаборника Нивы 2121.

И аккуратно, с минимальными зазорами вырезаем от ВАЗ-2108 место для «улитки». Установите его как показано на картинке (вид снизу)

Оставшуюся часть полости заполните пенополиуританом! Затем, после застывания, вырезаем заподлицо с днищем корпуса воздухозаборника.

Вот такая должна получиться Нива 2131 воздухозаборник!

Ставим уплотнитель и устанавливаем под капот!

Тюнинг салона Ваз 2121, Ваз 2131

Дополнительная панель приборов

Установка дополнительной панели приборов Нива 2121, ВАЗ 2131

Установка новой бороды

Новая борода от 21213 на Нива 2121, Ваз 2131

Доработка отопителя салона

Установка дополнительного вентилятора для улучшения внутреннего отопления Нива 2121, ВАЗ 2131

Панель приборов от Газ 3110 вместо стандартной панели

Панель приборов ГАЗ 3110 вместо панели Нива 2121, ВАЗ 2131

Подсветка замка зажигания от ВАЗ-2110

Установка освещения замка зажигания от 2110 на Нива 2121, ВАЗ 2131

Доработка обдува печки

Доработка печки Нива 2121, ВАЗ 2131

Доработка подсветки приборов

Доработка подсветки приборов старого щита Нива 2121, ВАЗ 2131

Установка новой улитки отопителя

Отопительная улитка от 2108 до Нива 2121, ВАЗ 2131

Индикатор расхода топлива

Установка указателя расхода топлива Нива 2121, ВАЗ 2131

Электропривод замка багажника

Установка электропривода замка багажника Нива 2121, ВАЗ 2131

Установка гидрокорректора фар

Гидрокорректор фар Нива 2121, ВАЗ 2131

Стеклоподъемники

Установка электростеклоподъемников Нива 2121, ВАЗ 2131

Тюнинг лада 2121, фотографии тюнинга лада 21213, доработка лада 2131

Тюнинг автомобиля ВАЗ — это повышение заводских характеристик автомобиля. Капитальный ремонт Нивы 2121 — это, прежде всего, установка новых бамперов, защиты картера и лебедки. По желанию владельцев этих внедорожников устанавливаются дополнительные противотуманные фары. В наших разделах описаны инструкции и советы по доработке Нивы 2131 различных агрегатов, например, раздатки и т.д. Сложную настройку судов своими руками может выполнить даже автомобилист. Вы также найдете категории по тюнингу двигателя, тюнингу коробки передач, тюнингу салона и кузова, а также множество фотоотчетов тюнинга ВАЗ 2121. Благодаря интересным решениям тюнинг Нивы доставит вам массу удовольствия и пользы. Если у вас есть фотографии тюнеров, напишите нам.

Схема подключения 08 вентилятора печки на ниву

Переделка печки на Ниве 21213 своими руками необходима при сбое в работе системы отопления автомобиля. Медлить с этим не стоит, ведь неравномерная термическая регуляция приводит к запотевшим стеклам или обледенению. В любом из указанных случаев ухудшается обзор происходящего на дороге. Неисправность вызывает износ отдельных элементов устройства или заводской брак.

Диагностирование неисправности

Потребуется переделка печки, поставляемой в штатной комплектации, в профилактических целях. Много времени процедура не отнимет, зато предотвратит множество проблем в будущем. Водительский опыт говорит о том, что первые сильные морозы подкосят «здоровье» устройства. Список основных слабых мест выглядит следующим образом:

  • оптимальный диапазон рабочей температуры модели 2121 от -5 до +10°С;
  • неспособность прогреть воздух в салоне, если за бортом -8°С и ниже;
  • при увеличении мощности обдува не происходит увеличение температуры;
  • при езде на II передаче шум от печки Нивы становится существенным.

Именно поэтому лучше заблаговременно принять необходимые меры. Альтернатив у водителя немного. С одной стороны, все остается на своих местах. Отопительное устройство используется на минимальной мощности. Во время мягких зим подобное еще терпимо, но с приходом настоящих холодов условия станут невыносимы. С другой стороны, несложно потратить несколько часов для исправления ситуации.

Дальнейшее развитие событий идет следующим образом. Если отопление в машине работает на ½ мощности, можно ограничиться незначительным ремонтом. Главное — убедиться в отсутствии шумов и посторонних стуков, иначе Нива 21213 должна немедленно отправиться на технический осмотр.


Наличие неприятного звукового сопровождения говорит о необходимости замены устройства. В специализированной торговой сети представлены готовые варианты отопительных механизмов на Ниву. При желании таковой собирается самостоятельно.

Второй вариант считается более предпочтительным. При самостоятельной сборке есть возможность в буквальном смысле персонализировать печку. Для выполнения работы своими руками понадобится посетить специализированный магазин или рынок для покупки запчастей.

При покупке выбираются оригинальные детали или аналоги. Главное, чтобы они имели сертификат качества. В противном случае поставить их нельзя. Нелишним будет переписать технические данные транспортного средства, чтобы не превысить рекомендованные заводом-изготовителем параметры.

Технические тонкости процедуры

Эффективность работы новой отопительной системы на Ниве определит не стоимость купленных деталей, а их качество. Для работы понадобятся следующие элементы: автомобильный резистор, отопитель восьмерки и «улитка». Ошибочно полагать, что подойдут только «родные» запчасти для ремонта отопительного устройства. Главное требование — техническая совместимость.

Как отремонтировать печку ВАЗ 2107? Из этой статьи вы все узнаете, а так же сможете произвести ее ремонт своими руками. Проблема ремонта печки ВАЗ 2107, как правило, возникает перед похолоданиями. Кто обращается в автосервисы, кто пытается сделать такой ремонт самостоятельно, но в любом случае никто не хочет ездить зимой на автомобиле с не работающей печкой.

Отечественный автопром, как бы о нем не отзывались, все же по-своему печется о пользователях автомобилей, которые они выпускают. Поскольку зимы в нашей климатической зоне суровые, то автомобили отечественного производства шли с конвейера с мощными системами отопления салона. Касается это и автомобилей Волжского автомобильного завода (ВАЗ). Все выпускаемые заводом модели, как «классика» ВАЗ-2101 – ВАЗ -2107, так и последующие, ВАЗ-2108 – ВАЗ-21099, ВАЗ-2110 и т.д. обладают хорошей системой отопления.

Если брать во внимание модели ВАЗа от 2101 до 2107, то система отопления у них идет одинаковая и состоит из одних и тех же составных частей, подводящего и отводящего патрубков, радиатора, кранов и электромотора с вентилятором. И хоть эта система довольно проста, но в процессе эксплуатации она может выйти из строя. Разберем на примере, как произвести ремонт печки ВАЗ 2107.


От слов к делу

У подводящего и отводящего патрубков, по сути, никакой нагруженной работы нет, они всего лишь перепускают жидкость из системы охлаждения в радиатор отопления салона и отводят обратно. Но бывают случаи, когда эти патрубки начинают давать течь. Протекать они могут в местах соединения, или же в случае трещины на самом патрубке.
Если подтеки появились в местах соединения, то нужно просто поменять в местах соединения резиновые прокладки. Если же на каком-либо патрубке появилась трещина, то есть несколько вариантов решения проблемы. Поскольку патрубки делаются из латуни, то трещину можно запаять или же на место, где протекает жидкость, можно наложить резиновую шину и закрепить ее хомутами. Если выходит из строя кран, то ремонту он не подлежит, его просто заменяют.

Не так все просто

Самым сложным случаем является засоренность трубок радиатора печки. В таком случае ремонт печки ВАЗ 2107 довольно затруднен, потому что радиатор сделан из латуни и в местах стыковок, составляющих радиатора, применялась пайка. Поэтому чтобы почистить радиатор, его нужно распаивать.

После того, как он распаян, трубки радиатора нужно тщательно прочистить. Сделав прочистку радиатор нужно снова запаять. Это является сложной операцией, поскольку в местах с не качественной пайкой радиатор будет протекать.

Важный момент — электромотор

Также в процессе эксплуатации печки ВАЗ-2107 возможен выход из строя электромотора. Спешить менять его не стоит, поскольку причиной неработающего эл. двигателя может быть окисление графитных щеток, из-за чего они не контактируют с ротором двигателя. В таком случае стоит просто разобрать электродвигатель и хорошо почистить посадочные места щеток. Если же двигатель начал «пищать», то скорее всего в нем вытекла смазка между статором и ротором.

Нужно разобрать двигатель и нанести новую смазку на посадочные места ротора. Также существует вероятность износа посадочных мест, поскольку двигатель не больших размеров и на нем не устанавливаются подшипники.


Ремонт такой поломки не возможен и электродвигатель просто заменяется.Поскольку двигатель, устанавливаемый на ВАЗ-2107 является маломощным, то часто владельцы этого автомобиля меняют его на более мощный, который устанавливается на ВАЗ-2108.

Но поскольку этот электродвигатель не подходит по посадочным местам в кожухе, то потребуется небольшая переделка кожуха.

Вопросу обогрева салона любого автомобиля следует уделять достаточное внимание, поскольку это благоприятствует не только повышению уровня комфорта, но и обеспечению безопасности во время осуществления движения. не способна устранить ледяное покрытие, возникшее на лобовом и боковых стёклах. Безусловно, стёкла, покрытые льдом, сводят видимость к нулевой отметке. Водителю только нужно применить механическое воздействие, чтобы ликвидировать хотя бы частично лёд, в противном случае имеется возможность ехать только вслепую, что чревато аварийными ситуациями.

К сожалению, печка на вашей Ниве хоть и имеет некоторые преимущества, но вместе с ними сопровождается некоторыми явными недостатками. В частности, одним из таких существенных недостатков является недостаточно мощный вентилятор, который не способен обеспечивать нормальную подачу тёплого воздуха, но при этом ещё его работа сопровождается чрезмерным посвистыванием и шумом. Конечно, кое-кто примет решение посетить автомагазин, выбрать новый вентилятор и установить его, распрощавшись со старым, приносящим вам, как водителю, проблемы. Однако большинство автовладельцев не считают такой вариант решения проблемы правильным. Установка нового элемента решит проблему только на некоторое время, а через определённый промежуток времени вновь вам придётся столкнуться с тем, что он начинает издавать раздражающие звуки и плохо гнать воздух.

Мы рекомендуем вам задуматься об установке на вашу Ниву. Как показывает практика, установка такой печки позволяет надолго забыть о проблеме плохого обогрева салона. Можно также модернизировать имеющуюся печку, воспользовавшись некоторыми комплектующими, взятыми с ВАЗ-2108.

Модернизация печки

Чтобы модернизировать печку на вашей Ниве, предлагаем вам позаимствовать, прежде всего, вентилятор печки ВАЗ-2108. Мы не рекомендуем его устанавливать вместо того, что уже установлен на вашей Ниве, кстати, это у вас вряд ли и получится, поскольку он располагается в салоне авто. Внедрить вентилятор от 2108 в салон будет проблематично, поэтому ему находят более подходящее пространство в моторном отсеке. Модернизация печки предполагает установку дополнительного вентилятора, чем мы и предлагаем заняться вам.

Алгоритм замены вентилятора

Первоначально предлагаем вам снять коробку воздухозаборника, который в водительской среде имеет и другое народное название «сапог». Снимать его самостоятельно не очень удобно, поэтому рекомендуем вам привлечь к выполнению этой процедуры своего друга. Неудобство заключается в том, что гайки нужно откручивать, находясь в салоне, а сами болты удерживать со стороны подкапотного пространства. Свободная ваша рука уж точно не достанет до подкапотного пространства. После того как все гайки будут откручены, снимите воздухозаборник.

Теперь вам предстоит выполнить некоторые манипуляции, чтобы переделать извлечённый воздухозаборник, а затем внедрить в него . В противном случае вам не удастся закрыть капот, поскольку вентилятор будет мешать замку.


Итак, вам нужно срезать на воздухозаборнике пластик сбоку, а на самом вентиляторе — выступающие в стороны детали крепления. После того как вентилятор отлично разместился во внутреннем пространстве воздухозаборника, закрепите его герметиком. Вокруг сопла вентилятора умостите подходящий материал. Это позволит вам исключить потерю оттока воздуха. Теперь водрузите ваш модернизированный кожух с вентилятором, попробуйте закрыть капот.

Алгоритм замены моторчика

Нелишним будет рассмотреть вопрос установки моторчика печки, заимствованной у «восьмёрки». В этом случае тоже удастся значительно улучшить работу печки. Снятый восьмёрочный моторчик также требуется первоначально примерить в воздухосборнике, при необходимости вырезать болгаркой дополнительное пространство, чтобы он успешно в нём мог разместиться. После того как вы убедитесь в его нормальной «посадке», рекомендуем моторчик зафиксировать герметиком, чтобы исключить возможную вибрацию в процессе передвижения на авто. Безусловно, родной движок следует выбросить, а все провода подключить к только что вами установленному механизму.


Моторчик печки от «восьмёрки»

Тюнинг салона нива 2121 своими руками, советы доработке салона, внутренний тюнинг нива 2131, ваз 2121. Установка новой улитки отопителя Доработка салона, тюнинг салона Нива 2121, Нива 2131, Нива 4×4

Установка новой улитки отопителя фото, тюнинг салона Ваз 2121, Ваз 2131 своими руками

Тюнинг автомобилей ваз — это повышение заводских характеристик автомобиля. Доработка нива 2121 — это прежде всего установка новых бамперов, защиты картера, лебедки. По желанию владельцы этих внедорожников устанавливают дополнительные противотуманные фары. В наших разделах описаны инструкции и советы по доработке нива 2131 различных агрегатов, таких как раздатка и т.д. Комплексный тюнинг ваз своими руками сможет сделать даже автолюбитель. Также вы найдете категории по тюнингу двигателя, тюнингу коробки передач, тюнингу салона и кузова, также множество фото отчетов тюнинга ваз 2121. Благодаря интересным решениям тюнинг нива доставит вам массу удовольствия и выгоды. Если у вас есть фотографии тюнинга ваз — присылайте нам на почту.

Печка в Ниве откровенно говоря плохая! Одной из ее самых важных проблем является собственно сам вентилятор, которые установлен под радиатором, да к тому же еще и вертикально. Проходя через него горячий воздух сильно нагревает его и вся смазка постепенно стекает с ротора. Как следствие моторчик начинает визжать! Наверное все знают эту проблему! Ну а производительность там вообще на нуле…

Проблема решаема!
Ставим «улитку» от ВАЗ-2108 и получаем увеличение производительности, тищину, и при желании три скорости управления.
Идея не нова, я позаимствовал ее на других сайтах. Только каждый делает по своему — вот как сделал я…

При всем этом, после переделки мотора печки вообще не слышно так как сам мотор теперь стоит в подкапотном пространстве!

Разбираем полностью весь отопитель!

При желании иметь три скорости — в нижнюю чать корпуса, со стороны водителя, врезаем резистор печки от ВАЗ-2108/М2141


Все стыки корпуса, а особенно место установки радиатора ваз 2121, проклеиваем резиновым уплотнителем (есть в любом строительном магазине)


Собираем нижнюю часть, двигатель ваз 2131 с вентилятором от туда просто выкидываем! Он нам больше не нужен!


Разбираем верхнюю часть отопителя, вынимаем решетку из воздухозаборника нива 2121…


И аккуратно с минимальными зазорами вырезаем место под «улитку» от ВАЗ-2108. Устанавливаем ее так, как позакано на фото (вид снизу)


Оставшуюся полость запоняем монтажной пеной! Затем, после застывания, срезаем ее вровень с нижней частью корпуса воздухозаборника.


Вот такой вот воздухозаборник нива 2131 должен получиться!


Одеваем уплотнитель и устанавливаем под капот!


Дополнительная панель приборов

Установка дополнительной панели приборов Нива 2121, Ваз 2131

Установка новой бороды

Новая борода от 21213 на Нива 2121, Ваз 2131

Доработка отопителя салона

Установка дополнительного вентилятора для улучшения обогрева салона Нива 2121, Ваз 2131

Панель приборов от Газ 3110 вместо стандартной панели

Панель приборов ГАЗ 3110 вместо панели Нива 2121, Ваз 2131

Подсветка замка зажигания от ВАЗ-2110

Установка подсветки замка зажигания от 2110 на Нива 2121, Ваз 2131

Доработка обдува печки

Доработка печки Нива 2121, Ваз 2131

Доработка подсветки приборов

Доработка подсветки приборов старой панели Нива 2121, Ваз 2131

petra: улитка 2108 в ниву

Одеваем уплотнитель и устанавливаем под капот!

Вот такой вот воздухозаборник нива 2131 должен получиться!

Оставшуюся полость запоняем монтажной пеной! Затем, после застывания, срезаем ее вровень с нижней частью корпуса воздухозаборника.

И аккуратно с минимальными зазорами вырезаем место под «улитку» от ВАЗ-2108. Устанавливаем ее так, как позакано на фото (вид снизу)

Разбираем верхнюю часть отопителя, вынимаем решетку из воздухозаборника нива 2121…

Собираем нижнюю часть, двигатель ваз 2131 с вентилятором от туда просто выкидываем! Он нам больше не нужен!

Все стыки корпуса, а особенно место установки радиатора ваз 2121, проклеиваем резиновым уплотнителем (есть в любом строительном магазине)

При желании иметь три скорости — в нижнюю чать корпуса, со стороны водителя, врезаем резистор печки от ВАЗ-2108/М2141

Разбираем полностью весь отопитель!

Печка в Ниве откровенно говоря плохая! Одной из ее самых важных проблем является собственно сам вентилятор, которые установлен под радиатором, да к тому же еще и вертикально. Проходя через него горячий воздух сильно нагревает его и вся смазка постепенно стекает с ротора. Как следствие моторчик начинает визжать! Наверное все знают эту проблему! Ну а производительность там вообще на нуле… Проблема решаема! Ставим «улитку» от ВАЗ-2108 и получаем увеличение производительности, тищину, и при желании три скорости управления. Идея не нова, я позаимствовал ее на других сайтах. Только каждый делает по своему — вот как сделал я… При всем этом, после переделки мотора печки вообще не слышно так как сам мотор теперь стоит в подкапотном пространстве!

Улитка отопителя от 2108 на Нива 2121, Ваз 2131, Лада 4х4

Тюнинг салона нива 2121 своими руками, советы доработке салона, внутренний тюнинг нива 2131, ваз 2121.

НИВА / 2121, 2131 / тюнинг / салона / Установка новой улитки отопителя

Улитка отопителя от 2108 на Нива 2121, Ваз 2131

Доработка печки Нива (Шевроле, 21213-4 и др.) » МОДЕРНИЗАЦИЯ+УЛУЧШЕНИЕ отопителя

Содержание:
  1. Из чего состоит «система отопления»
  2. Возможные недостатки или поломки отопителя LADA 4×4
  3. Как улучшить работу отопителя, какую печку поставить на Ниву
  • Будем на связи!
  • Всем привет! Россия – страна не только большая, но ещё и холодная. У нас, как и в большинстве стран постсоветского пространства зимой холодно. Сейчас уже осень, а потому сегодня пойдёт разговор о различных вариантах как допилить-докрутить-доделать «родную» печку Нива 21213.

    Из чего состоит «система отопления»

    Модернизация печки «Нива» начинается с изучения конструкции, с которой предстоит иметь дело. Если не брать во внимание самые современные и весьма дорогие модели Lada с иностранной начинкой, то обогрев салона вкупе с его вентиляцией устроен почти во всех машинах ВАЗ плюс-минус одинаково. Попробуем разобрать всё это «на пальцах».

    Нива

    При движении машины через «жабры» в капоте поток уличного воздуха попадает в довольно простую систему пластиковых трубок различного сечения и диаметра. Нагрев воздуха обеспечивает радиатор, к которому подведены каналы на печку – трубки ввода-вывода охлаждающей жидкости, посредством которой происходит, собственно, охлаждение силового агрегата.

    Циркуляцию нагретого воздуха обеспечивает вентилятор с электромотором. Добавить или убавить температуру позволяет кран печки. Он, как и заслонки отдельных дефлекторов имеет тросовый привод. Управление всем этим нехитрым хозяйством выведено на центральную панель «Нивы». Водитель переводит рычаг в нужное положение и трос, соответственно, открывает-закрывает кран печки. Второй рычаг позволяет оперировать трёхрежимным вентилятором, способным дуть сильнее, слабее и в среднем диапазоне. Наконец, третий рычажок меняет расположение заслонок дефлекторов, переводя поток в ноги, на лобовое стекло или в салон.

    Не сказать, что всё это архисложно или заумно.

    Шеви Нива

    У чуть более современного образца автомобиля Нива… всё то же самое. За исключением чуть более современного внешнего вида органов управления печкой. В остальном это всё та же конструкция из пластика с системой воздуховодов, салонным фильтром и версией с кондиционером. Последний, правда, установлен под капотом, а никак не интегрирован в структуру подторпедного пространства. Разве что в пространство между радиатором и вентилятором выведен испаритель, который, при включенном кондиционере охлаждает циркулирующий поток воздуха.

    Справедливости ради уточним, что на свежих моделях классического внедорожника, на той же Нива Урбан, оснащаемой кондиционером, тоже может присутствовать аналогичное решение.

    Назад к содержанию

    Возможные недостатки или поломки отопителя Lada 4×4

    Перечислив частично элементы конструкции ВАЗовской печки, мы, пожалуй, заодно «набросали» круг проблем по данному узлу в автомобиле Нива 21214, с которыми может столкнуться любой владелец данной машины.

    • Стойкий «аромат» тосола в салоне авто свидетельствует, что потёк кран отопителя.
    • Не удаётся перенаправить тёплый воздух с лобового стекла на обогрев салона? Легко мог оборваться тросик, связывающий рычаг с заслонками.
    • Пропал характерный шум вентилятора и перестал дуть воздух в салон? Поздравляем – пришло время разбирать панель и менять электровентилятор печки.
    • Неравномерно распределяется поток воздуха (это больше доработка отопителя Шевроле Нива)?! Придётся установить новые пластиковые направляющие пластины, чтобы заслонки более чётко занимали своё положение. Ещё вариант – доработка воздуховодов, но тут уже каждый пробует свои инженерные решения.

    И… простите, но это далеко не полный перечень вероятных неполадок. Так уж распорядился создатель любимого почти всеми покорителями бездорожья автомобиля, что всегда найдётся, что доделать-дошлифовать в Ниве. Начиная с того, что сам вентилятор дует часто еле-еле и при этом шумит, как ракетный двигатель, заканчивая тем, что воздух, как уже было указано ранее, поступает в салон машины исключительно с улицы, а потому при закрытом лючке циркуляция воздуха внутри авто прекращается. Чтобы справиться с этим недостатком многие умельцы… выпиливают в корпусе печки отверстие.

    Также, могут быть повреждены/изношены/изначально не совпадать патрубки отопителя. Наконец, элементарный резистор, отвечающий за режимы работы вентилятора, очень даже нередко выходит из строя.

    Назад к содержанию

    Как улучшить работу отопителя, какую печку поставить на Ниву

    На просторах Сети полным-полно ценных (и не очень) советов по приведению в порядок отечественного внедорожника с уже более чем 40-летней историей! И доработка печки «Нива» в этом наборе занимает отдельное место.

    Перебрать всё подряд

    Первый и наиболее очевидный вариант улучшения качества работы любого механизма – обслужить его. Бывалые механики советуют начинать ремонт печки Нивы того, что меняем шланги подачи, а заодно и хомуты. Со временем каждая резинка или фитинг могут зачерстветь, задубеть и перестать работать, как следует.

    Мотор печки, какой лучше

    Для опытного Нивавода не секрет, что производительность «родного» мотора отопителя оставляет желать много лучшего. Поэтому его часто меняют на схожий элемент из ВАЗ-2108. Так дует лучше, хотя с процессом установки придётся повозиться – в Сети можно найти пошаговый разбор этого улучшения.

    Впрочем, существует готовая печка на Ниву, которую легко установить и подключить взамен штатного устройства. Она укомплектована надёжным и долговечным вентилятором «LUZAR»:

    Ставим второй вентилятор

    Есть и более радикальный метод. Задумываясь – какой лучше радиатор печки установить или как частично довести её до ума, многие владельцы Нивы всё же приходят к выводу, мало установить новую печку – нужно обеспечить постоянный приток воздуха. Для этого в корпусе воздухозаборника устанавливается дополнительный вентилятор от ВАЗ-2108 по принципу «улитка».

    Ну, мотор тоже можно обновить – есть чуть модернизированный вариант от «Калины»:

    Защитная сетка – дёшево и просто

    Наблюдательные водители легко заметят, что в кожухе воздухозаборника и даже в решётке радиатора отопителя скапливается много мусора и грязи. Всё это физически препятствует притоку воздуха, а потому элементарная прочистка и промывка позволяют облегчить поступление воздуха в машину. А чтобы не повторять процедуру ежемесячно – достаточно кустарным способом соорудить элементарную сетку из капрона и проволочного каркаса и установить её на входном отверстии воздухозаборника. И не нужно ломать голову над извечными вопросами: Кран отопителя, какой лучше? Менять ли радиатор? Нужна ли замена мотора печки, если он дует нормально и не шумит?

    Тюнинг для пассажиров: отопитель второго ряда

    Дополнительный отопитель салона на семейства «Нива» устанавливается под переднее пассажирское кресло, а предназначен для подачи тепла в ноги пассажиров заднего ряда. Имеет две скорости работы и позволяет эффективно, и быстро обогревать салон внедорожника.

    Назад к содержанию

    Будем на связи

    В общем, на этом вопросы про улучшение печки Нива и тему «доработка печки Нива Шевроле» считаем завершённым. Напоминаем, что компания SV-PARTS присутствует во многих социальных сетях. Также различные полезные статьи публикуются в нашем блоге.

    Присоединяйтесь к нам в VK и в Instagram. А также подписывайтесь на наш YouTube-канал, где часто размечаются рекомендации по подбору запчастей на автомобиль Нива.

    Вернуться к списку статей

    Флуоресцентный пигмент позволяет различать виды улиток-двойников

    ВВЕДЕНИЕ

    Окраска мягкого тела обычно не используется в качестве ключевого признака в таксономии раковинных моллюсков, в основном потому, что для изучения цвета и окраски необходимы живые или свежие экземпляры вариации сохраняются не так легко, как структурные вариации раковины или мягкого тела (Stum et al., 2006). У слизней окраска мантии может различаться генетически (Williamson, 1959) или в зависимости от пищи внутри вида, что вносит путаницу в таксономию близкородственных видов (Reise, 1997; Jordaens et al., 2001). Что касается окраски мантии легочных улиток, то практически не было изучено почти ни одного случая приобретенного изменения и лишь несколько примеров генетической изменчивости (Саin, 1959; Murray, 1963; Cain et al., 1968; Wolda, 1969; Richards, 1973). , 1978), возможно, потому, что в целом раковины привлекают гораздо больше внимания.

    Различия в окраске мантии между Bradybaena pellucida Kuroda и Habe (Habe, 1953) и B. Similaris (Rang, 1831) открывают возможности для биологических исследований окраски мантии из-за их подходящих характеристик для полевых и лабораторных исследований (Asami et al., 1997б; Асами и Асами, 2008 г.). Bradybaena Similaris (Férussac, 1821), которая часто упоминается для этого вида, является nomen nudum (Cowie, 1997). Первоначально Bradybaena pellucida была описана как немного отличающаяся от B. Similaris более высокой раковиной с более широкими оборотами, более тонким остракумом и блестящим бледно-желтоватым периостракумом, через который гепатопанкреас выглядит ярко-желтым вблизи вершины, при этом не обнаруживая явных различий в цвете. гениталии (Набе, 1953). Однако отчетливый желтый цвет B.pellucida имеет цвет не гепатопанкреаса, а спинной мантии (Asami et al., 1997b; Seki et al., 2002). В отличие от этого, B. Similaris демонстрирует окраску внутренних органов через почти прозрачную мантию с некоторыми белыми участками на вершине (рис. 1А). Цвет наружного покрова мягкого тела, выходящего за пределы раковины, от беловатого до бледно-светло-коричневого у B. pellucida, но более темно-коричневый у B. Similaris. Цвет периостракума часто бледно-беловато-желтый у B. pellucida, но коричневатый у B.аналогичный (рис. 1Б). Однако различия в раковинах непостоянны из-за различий внутри каждого вида. Оба вида также имеют схожие генетические системы, контролирующие окраску раковины и полиморфизм полос (Asami et al., 1993, 1997a; Asami and Asami, 2008). Таким образом, B. pellucida и B. Similaris надежно различаются только по окраске мантии. Однако, когда B. pellucida кормят искусственно приготовленным кормом (Asami and Ohbayashi, 1999), он теряет желтую окраску мантии, и его становится трудно отделить от B.Similaris (Asami et al., 1997a, b). Таким образом, было сомнительно, отличаются ли эти два вида генетически или морфологически друг от друга.

    Рис. 1

    Внешняя морфология Bradybaena pellucida (слева на каждой панели) и B. Similaris (справа на каждой панели). (A) Живые взрослые особи светло-коричневых полосатых морфов. (B) Пустые раковины взрослых светло-коричневых бесполостных морф; масштабная линейка, 5 мм.

    Bradybaena pellucida является эндемиком Японии и распространена в основном в западном регионе, а также на юге полуострова Босо и некоторых других местах в центральной части Хонсю, тогда как B.Similaris является космополитом и населяет большинство островов Японии (Komai, Emura, 1955; Asami et al., 1997b; Seki et al., 2002). Смешанные колонии B. Similaris и B. pellucida обнаруживаются там, где их ареалы перекрываются, хотя их пятнистое распространение может быть отрицательно связано друг с другом (Asami et al., 1997b; Seki et al., 2002).

    Мы изучили различия между B. pellucida и B. Similaris в пигментации мантии, морфологии полового члена и аллозимах. В этой статье показано, что флуоресцентный вторичный метаболит, который B.pellucida из естественной среды, подтверждает генетическое различие двух видов.

    МАТЕРИАЛЫ И МЕТОДЫ

    Для изучения окраски мантии и морфологии гениталий мы собрали живых взрослых особей и молодых особей (диаметром от 6 до 7 мм) B. pellucida в Широяме, Татеяме, и B. Similaris в Мияме, Фунабаси, Япония ( Рис. 2). Для исследования аллозимной изменчивости мы собрали образцы из трех одновидовых популяций каждого вида, в том числе из двух вышеуказанных участков на полуострове Босо (рис.2).

    Рис. 2

    Места сбора Bradybaena pellucida и B. Similaris в префектуре Тиба, Япония.

    В течение двух дней после сбора мы удалили раковины 20 взрослых и 20 молодых особей каждого вида и исследовали спинную мантию под препаровальным микроскопом. Кроме того, мы кормили 20 взрослых особей и 20 молодых особей каждого вида кормом, состоящим из порошкообразной овсяной муки, яичной скорлупы и сухого корма для кошек, в контролируемых лабораторных условиях (16 часов света/8 часов темноты, 25°C) в течение 30 дней в соответствии с рекомендациями. протокол Асами и Обаяши (1999).Затем таким же образом, как описано выше, мы исследовали спинную мантию.

    Из-за заметной яркости желтой пигментации B. pellucida мы проверили, излучает ли желтое вещество флуоресценцию в ультрафиолетовом излучении А, используя УФ-люминесцентную лампу (Blacklight, NEC, FL20S-BLB; пиковая длина волны: 360 нм). во тьме. Для каждого вида мы исследовали (1) спинную мантию 20 взрослых особей и 20 молодых особей в течение двух дней после сбора, (2) спинную мантию 20 взрослых особей и 20 молодых особей, которых кормили в лаборатории в течение 30 дней, и (3) пустые оболочки 20 взрослых.

    Мы вырастили 20 мальков B. pellucida и B. Similaris, собранных в Сирояме и Мияме, соответственно, до зрелости в индивидуальных пластиковых контейнерах (62×50×25 мм) и позволили им размножаться в 10 межвидовых парах, согласно протокол Asami and Ohbayashi (1999), за исключением использования песка в качестве субстрата для откладки яиц. Мы вырастили до половой зрелости по пять потомков каждой из четырех межвидовых пар. Изучив цвет мантии и морфологию гениталий, мы подтвердили, что потомство было межвидовым гибридом, а не потомством, полученным путем самоопыления, на основе их гетерозиготного аллозимного профиля в локусе Pgm (таблица 1).В качестве контроля мы вырастили до половозрелости по пять потомков каждой из четырех внутривидовых пар каждого вида в тех же лабораторных условиях, что и гибриды.

    Таблица 1

    Анализируемые ферменты и локусы, а также буферные системы, используемые при электрофорезе в крахмальном геле.

    Мы препарировали половую систему 20 взрослых особей каждого из двух видов, собранных в дикой природе, и по 20 взрослых особей каждого вида и гибридов F 1 , полученных в результате лабораторных скрещиваний. Мы фиксировали гениталии в 70% этаноле.Под препаровальным микроскопом мы исследовали возможные различия общей морфологии гениталий и скульптуры внутренней стенки полового члена, вскрытой в постоянной ориентации с помощью лезвия бритвы.

    Кусочек гепатопанкреаса каждого живого образца гомогенизировали в равном объеме холодного 0,01 М трис-HCl-буфера (рН 6,8) и центрифугировали при 10000× g в течение 10 мин при 4°С. Супернатант подвергали электрофорезу на горизонтальном крахмальном геле с использованием четырех буферных систем для 11 ферментов (табл. 1).Аллозимы наблюдали с помощью методов окрашивания Murphy et al. (1996). Основываясь на электрофоретических паттернах, мы оценили частоты аллелей в 12 предполагаемых локусах.

    РЕЗУЛЬТАТЫ

    Пигментные пятна

    Как у B. pellucida, так и у B. Similaris у всех взрослых и молодых особей, собранных в дикой природе, было много пятен диаметром 0,01–0,02 мм каждое в спинной мантии под раковиной (рис. 3). ). Пятна B. pellucida были ярко-желтыми, тогда как пятна B. Similaris были белыми; оба типа были видны сквозь полупрозрачные оболочки.Пигментные пятна были только в спинной мантии, а не в других частях мантии или в других органах. У большинства взрослых особей B. pellucida, собранных в дикой природе, желтые пятна сливались, покрывая дорсальную поверхность шипа, который казался толстым и однородно желтым. Таким образом, цвет гепатопанкреаса не был виден сквозь скорлупу у живых взрослых особей B. pellucida. Желтые пятна были редкими на внешних оборотах. Окраска гепатопанкреаса имаго B. pellucida была видна вдоль узкой зоны между оборотами только при удалении раковины (рис.3А). В противоположность этому, белые пятна B. Similaris были плотными только на вершине и редко располагались в дорсальной части мантии шпиля. Так, у B. Similaris в основном наблюдалась темно-коричневая окраска гепатопанкреаса через мантию и раковину (рис. 3Б).

    Рис. 3

    Зависящие от окружающей среды изменения окраски мантии и гепатопанкреаса у взрослых особей Bradybaena pellucida (левые панели) и B. Similaris (правые панели). (A, B) Вид шпиля сверху без скорлупы до лабораторного кормления. (В, Г) Пятна, внедренные в мантию перед лабораторным кормлением; масштабная линейка, 0,05 мм. (E, F) Вид сверху на шпиль без скорлупы на 30-й день лабораторного кормления.

    Плотность и распределение пятен на мантии различались у диких особей. Желтые пятна молодых B. pellucida из дикой природы были менее плотными, чем у взрослых особей; таким образом, их цвет гепатопанкреаса был виден сквозь скорлупу. В среде обитания B. pellucida типичная желтая окраска не обнаруживалась у большинства мальков размером менее 4 мм.Однако у собранных взрослых и молодых особей желтые пятна были слишком плотными вокруг вершины, чтобы можно было проверить, присутствуют ли также белые пятна.

    В лабораторных условиях все дикие взрослые и ювенильные экземпляры B. pellucida начали терять желтую окраску с первого дня эксперимента, в то время как белые пятна B. Similaris не показали заметных изменений. В контейнерах, в которых взрослые или молодые особи B. pellucida содержались по отдельности, следы слизи на влажном бумажном полотенце, выстилавшем дно, часто были полупрозрачно-желтыми, особенно в начале лабораторного кормления, что позволяет предположить, что желтый пигмент просачивается из тела, предположительно со слизью.Мы подтвердили, что это также происходит в дикой природе, когда люди ползают по белой папиросной бумаге.

    Хотя скорость исчезновения желтого цвета у разных особей различалась, все взрослые особи и молодые особи B. pellucida полностью утратили желтый пигмент в течение 30 дней. Однако мы не обнаружили никаких заметных признаков изменений в питании или других поведенческих действиях. Сняв раковины на 30-й день кормления, мы обнаружили только белые пятна на спинной мантии как у B. pellucida, так и у B. Similaris (рис.3). Эти пятна были такими же редкими, как и пятна на мантии B. Similaris до эксперимента с кормлением. Цвет самой гепатопанкреаса резко менялся от темно-коричневого до бледно-коричневого как у B. pellucida, так и у B. Similaris (рис. 3). Из-за изменения количества желтых пятен и окраски гепатопанкреаса взрослые и ювенильные особи двух видов стали неотличимы друг от друга по мягкотелой окраске под раковиной.

    Под воздействием ультрафиолетового (УФА) излучения с длиной волны 360 нм все живые взрослые особи и молодые особи B.pellucida, собранные из природных местообитаний, излучали беловатую флуоресценцию, видимую человеческому глазу в темноте. При облучении УФ-А мягкого тела без панциря и листа спинной мантии, удаленного от тела, мы подтвердили, что только желтая часть спинной мантии излучает флуоресценцию. Желтые пигменты, обнаруженные со следами слизи на бумажном полотенце, также флуоресцировали даже после того, как бумажное полотенце и слизь высохли. Напротив, мы не обнаружили флуоресценции в мягких телах B.Similaris или B. pellucida, утративший желтый пигмент. Пустые раковины двух видов не проявляли ни желтого пигмента, ни флуоресценции. Ни один из 20 гибридов F 1 , выращенных в лаборатории, не приобрел желтый пигмент и не излучал флуоресценции.

    Генитальная анатомия

    Не было обнаружено различий в общей морфологии гениталий между B. pellucida и B. Similaris. Однако узоры микроскульптуры внутри пениальной трубки различались между двумя видами, хотя они мало различались у взрослых особей.Пениальная скульптура B. pellucida (рис. 4) характеризуется ромбовидными пустулами, разделенными прямыми тонкими бороздками и покрывающими более половины внутренней стенки от края семяпровода (верхний край на рис. 4). На краю несколько тонких неясных продольных пилястр. Некоторые из них частично зигзагообразные. Отдельные пустулы сливаются, образуя толстые продольные пилястры примерно на одной трети полового члена проксимальнее полового отверстия (нижний край на рис. 4).Продольные края этих пилястр слабозубчатые, но не разветвлены и не сращены друг с другом. Внутренняя пениальная поверхность B. Similaris (рис. 4) в основном покрыта пилястрами, идущими от края семявыводящего протока к половому отверстию. Эти пилястры различаются по ширине. В части, проксимальнее семявыносящего протока, пилястры тонкие, большей частью зубчатые и сжатые. На большей части внутренней поверхности полового члена пилястры разветвлены и в значительной степени зубчатые, сливаются в несколько крупных пилястр возле полового отверстия.

    Рис. 4

    Скульптура на внутренней стенке полового члена взрослой особи Bradybaena pellucida (слева), B. Similaris (справа) и их гибрида F 1 (в центре). Верхний край является краем семявыносящего протока, а нижний край продолжается до полового отверстия. Масштабная линейка, 1 мм.

    Все 20 исследованных гибридов F 1 отличались от родительских видов пениальной скульптурой (рис. 4). Присутствовали пустулы неправильной формы с несколькими мелкозубчатыми пилястрами примерно на одной трети стенки полового члена рядом с семявыводящими протоками.Таким образом, площадь с пустулами у гибридов была меньше, чем у B. pellucida. Более половины площади внутренней стены, проксимальной к гениальному отверстию, было покрыто выступающими пилястрами. Эти пилястры были длиннее, чем у B. pellucida, и толще, менее разветвлены и менее зубчатые, чем у B. Similaris. Этот образец скульптуры полового члена у гибридов F 1 кажется промежуточным между таковыми у B. pellucida и B. Similaris.

    Аллозимная вариация

    Из 12 предполагаемых локусов, кодирующих 11 исследованных ферментов, шесть локусов из пяти ферментов были полиморфными в шести популяциях B.pellucida и B. Similaris (табл. 2). Два вида имеют наиболее распространенный аллель в двух локусах, Aat и Idh . Однако в других локусах частоты аллелей заметно различались между видами. На Cap Locus Cap Cap 80034 80034 был самым распространенным в B. Pellucida, тогда как Cap

    или CAP или CAP

    2 100 был наиболее частым в B. Anderis. В Mdh-I три популяции B.Similaris были зафиксированы для Mdh-I 100 , редко встречающегося у B. pellucida. Точно так же при Mdh-II три популяции B. Similaris были зафиксированы для Mdh-II 100 , в то время как три популяции B. pellucida были полиморфны по двум другим аллелям. Все три популяции B. pellucida были зафиксированы для Pgm 100 , а B. Similaris — для Pgm 45 .

    Таблица 2

    Частоты аллелей, гетерозиготность (H) и значения F ST для полиморфных аллозимных локусов в этом исследовании.

    Средняя гетерозиготность составила 11% у B. Similaris и 20% у B. pellucida. Величина F ST не превышала 0,08 ни в одном локусе (табл. 2). Средние генетические расстояния (Nei, 1972) по 12 исследованным локусам составили 0,2384 между двумя видами и 0,0071 внутри вида (0,0064 для B. pellucida; 0,0077 для B. Similaris) (табл. 3).Разница между меж- и внутривидовыми генетическими дистанциями была статистически значимой (критерий Манна-Уитни, р=0,0014). Двадцать потомков F 1 , полученных от четырех межвидовых пар, были все гетерозиготными по Pgm 100 и Pgm 45 соответственно, для которых родительские популяции B.lucida, сходные с B. были зафиксированы, что указывает на то, что они были межвидовыми гибридами, а не результатом самоопыления.Таблица 3

    ОБСУЖДЕНИЕ

    Флуоресцентный пигмент мантии

    Желтые пигменты просачиваются из мягкого тела в естественной среде обитания, а также в лаборатории. Таким образом, лабораторные условия не являются непосредственной причиной потери пигмента. Вместо этого лабораторные условия, вероятно, препятствовали восполнению пигмента, возможно, потому, что искусственная пища не обеспечивала необходимое вещество (вещества) для производства пигмента.Мелкая молодь B. pellucida в дикой природе вообще не имеет желтой окраски или проявляет ее слабо. Это говорит о том, что B. pellucida в дикой природе накапливает желтое вещество в виде пятен по мере своего роста.

    Мы не обнаружили желтых пятен в мантии B. pellucida, потерявшей желтый цвет в лабораторных условиях. Вместо этого присутствовали редкие белые пятна, похожие на пятна B. Similaris. В середине лабораторного периода кормления оставшиеся желтые пятна B. pellucida мало менялись по цвету.Таким образом, желтые пятна не сменились белыми пятнами, а исчезли, а белые пятна B. pellucida, вероятно, присутствовали за плотными желтыми пятнами с начала опыта.

    Различия в окраске мантии между двумя видами могут быть результатом различий в пище и/или микросреде обитания. Однако типы их местообитаний во многом пересекаются, и иногда они встречаются вместе. Тем не менее, при тщательном изучении ареала распространения в Японии не было обнаружено ни одного экземпляра с желтой окраской у B. Similaris (e.г., Комаи и Эмура, 1955; Асами и Охба, 1982). Это говорит о том, что пигмент мантии B. pellucida, зависящий от окружающей среды, является признаком генетического отличия от вида-близнеца, B. Similaris.

    Нет сведений о подобных флуоресцентных метаболитах в других легочных, за исключением случая флуоресцентных пигментов, обнаруженных в слизи Cepaea nemoralis (L.) (J. Murray, личное сообщение). Хотя некоторые банановые слизни (род Ariolimax) известны своей ярко-желтой окраской (Gordon, 1994), неизвестно, зависят ли их цветовые вариации от окружающей среды в какой-либо степени.Слизень Arion fasciatus (Nilsson) терял желто-оранжевые пигменты мантии при выращивании на моркови, салате или бумаге, в то время как A. fasciatus и A. silvaticus Lohmander, выращенные на европейской крапиве Urtica dioica L., давали более сильную пигментацию, чем дикие особи ( Йорданс и др., 2001). В нашем предварительном эксперименте с кормлением морковь, салат или сладкий картофель не предотвращали потерю пигмента у взрослых или молодых B. pellucida, собранных в дикой природе, и не позволяли их потомству приобретать пигмент.Bradybaena pellucida часто встречается на японской крапиве Boehmeria nipononivea Koidz того же семейства (Urticaceae), что и европейская крапива.

    В естественных и лабораторных условиях желтый пигмент просачивается со слизью из тела B. pellucida. Подобные примеры известны у слизней; Arion subfuscus (Draparnaud) и A. hortensis Férussac отличаются от других арионид выделением желто-оранжевой слизи (Kerney, Cameron, 1979), хотя неизвестно, теряют ли они окраску мантии в неволе.Arion fasciatus в естественных условиях имеет бесцветную слизь, но при выращивании на крапиве выделяет оранжевую слизь (Jordaens et al., 2001). Таким образом, данный случай не может быть уникальным для B. pellucida среди ракушечных легочных, и подобные примеры могли быть просто упущены из виду из-за традиционно предвзятого внимания к раковинам.

    Несмотря на непрерывную потерю пигмента, B. pellucida накапливает пигмент, проявляя флуоресцентный желтый цвет и делая вид сверху заметным, по крайней мере, для человеческого глаза.В настоящее время неизвестно, есть ли какая-либо причина того, что флуоресценция и / или ярко-желтая спинная мантия обнажается через раковину. Изучение возможной функции пигмента требует дальнейших исследований экологии и эволюции B. pellucida. Химическая идентификация пигмента также необходима, чтобы понять, как он поступает из окружающей среды.

    Пениальная скульптура

    Принимая во внимание большое сходство двух видов в раковине и общей морфологии гениталий, а также в поведенческих и репродуктивных признаках, отраженное в успехе гибридизации, дискретное различие в сложной пениальной скульптуре между B.pellucida и B. Similaris. Наш результат показывает, что образцы скульптуры полового члена расходятся быстрее, чем другие морфологические признаки. Настоящее исследование показало, что гибриды F 1 демонстрируют пениальную анатомию, промежуточную между отличной микроскульптурой родительских видов. Таким образом, различия в скульптуре полового члена между двумя видами могут быть полигенными или определяться одним или несколькими генами, которые не проявляют полного доминирования.

    Микроскульптура стенки полового члена часто используется для различения близкородственных видов легочных артерий (например,г., Эмбертон, 1991; Sutcharit и Panha, 2006). Это говорит о том, что скульптура полового члена развивается относительно быстро и, таким образом, может играть роль в физическом распознавании партнера при совокуплении, хотя этот аспект до сих пор привлекал мало внимания. Поскольку скульптура полового члена может функционировать только после обнажения полового члена (Asami et al., 1998), эволюционный сдвиг в скульптуре мог создать барьер для скрытой репродуктивной изоляции, возникающей в процессе совокупления, вместо посткопулятивного презиготического барьера. (Ховард, 1999).

    Генетическое различие

    Настоящее исследование аллозимов было направлено на генетическое различие двух видов и не ставило целью исчерпывающее изучение аллозимной изменчивости в пределах их ареалов. Наш аллозимный анализ показал, что генетическая дистанция в 12 исследованных локусах между B. pellucida и B. Similaris значительно больше, чем внутри обоих видов. Различия между видами были наиболее очевидны по локусам Pgm и Mdh-I . Внутри каждого вида F ST указывает, что различия между тремя популяциями составляли всего 8% от общей генетической изменчивости.Средняя гетерозиготность была немного выше у B. pellucida, чем у B. Similaris, потому что первый был изменчив в четырех локусах, а второй — в двух. Выяснение истории популяции с помощью исследований генетической изменчивости в достаточном количестве мест в более крупном географическом масштабе требует дальнейших исследований.

    Наши результаты показывают, что B. pellucida и B. Similaris дают жизнеспособные гибриды F 1 , которые могут вырасти до зрелости без явного разрушения. Однако сила постзиготической изоляции должна быть определена количественно путем явной оценки приспособленности гибридов.Текущие результаты подчеркивают важность дальнейшего изучения интрогрессии и репродуктивной изоляции между двумя видами.

    Благодарности

    Мы благодарим Kurt Jordaens, Georg Armbruster, James Murray и Robert Cowie за комментарии, а также Masatoyo Okamoto, Hiroshi Fukuda, Kiyonori Tomiyama, Naoko Asami и Mao Asami за полевой сбор. Это исследование было частично поддержано JSPS Grants-in-Aid for Scientific Research для T.A.

    ССЫЛКИ

    1.

    Т.Асами и Н. Асами . 2008. Механизм поддержания супергена полиморфизма окраски раковины у Bradybaena Similaris. Бастерия 72: 119–127. Google ученый

    2.

    Т. Асами и С. Охба . 1982. Полиморфизм раковины наземной улитки Bradybaena Similaris в округе Канто. Научный представитель Takao Mus Nat Hist 11:13–28. Google ученый

    3.

    Т. Асами и К. Обаяши . 1999. Влияние субстрата для откладки яиц на пожизненную плодовитость наземных легочных Bradybaena Similaris.Дж. Конхол 36: 1–9. Google ученый

    4.

    Т. Асами, Х. Фукуда и К. Томияма . 1993. Наследование полосчатости раковины у наземной улитки Bradybaena pellucida. Венера 52: 155–159. Google ученый

    5.

    Т. Асами, К. Обаяши и К. Секи . 1997а. Наследование окраски раковины у наземной улитки Bradybaena pellucida. Венера 56: 35–39. Google ученый

    6.

    Т. Асами, Х. Ямасита, Дж. Парк и Х. Исикава . 1997б. Географическое распространение наземной улитки Bradybaena pellucida (Pulmonata: Bradybaenidae). Юриягай 5:31–42. Google ученый

    7.

    Т. Асами, Р. Х. Коуи и К. Обаяши . 1998. Эволюция зеркальных изображений в результате сексуально асимметричного брачного поведения у улиток-гермафродитов. Ам Нат 152: 225–236. Google ученый

    8.

    Эй Джей Кейн 1959. Наследование окраски мантии у Hygromia striolata (C. Pfeiffer). Дж. Конхол 24: 352–353. Google ученый

    9.

    Эй Джей Кейн, П. М. Шеппард и Дж. М. Б. Кинг . 1968. Исследования Cepaea I. Генетика некоторых морф и разновидностей Capaea nemoralis (L.). Фил Транс Рой Сок Лонд Б. 253: 383–396. Google ученый

    10.

    Р. Х. Коуи 1997.Каталог и библиография неместных неморских улиток и слизней Гавайских островов. Епископ Мус Оккас Пап 50: 1–66. Google ученый

    11.

    К. Эмбертон 1991. Генитальная, аллозимная и конхологическая эволюция трибы Mesodontini (Pulmonata: Stylommatophora: Polygyridae). Малакология 33:71–178. Google ученый

    12.

    A.E.J.P.J. Fd’A de Férussac 1821. 1822. Tableaux systématiques des animaux mollusques classés en familles naturelles, dans lesquels on a établi la concordance de tous les systèmes; suivis d’un prodrome générale pour tous les mollusques terrestres ou fluviatiles, vivants ou окаменелости.Бертран. Пэрис Сауэрби. Лондон. Google ученый

    13.

    Д. Г. Гордон 1994. Полевой справочник Западного общества малакологов по слизням. Книги снежного человека. Сиэтл. Google ученый

    14.

    Т. Хабе 1953. Наземные моллюски Сатаномисаки, самого южного острова Кюсю. Венера 17: 202–207. Google ученый

    15.

    DJ Ховард 1999. Приоритет и видообразование конспецифических сперматозоидов и пыльцы.Энн Рев Экол Сист 30: 109–132. Google ученый

    16.

    К. Йорданс, П. Ван Риэль, С. Гинен, Р. Верхаген и Т. Бакеляу . 2001. Пигментация тела, вызванная пищей, ставит под сомнение таксономическую ценность цвета самооплодотворяющихся слизней Carinarion spp. Дж. Молл Стад 67: 161–167. Google ученый

    17.

    М. П. Керни и Р. А. Д. Кэмерон . 1979. Полевой справочник наземных улиток Великобритании и Северо-Западной Европы.Коллинз. Лондон. Google ученый

    18.

    Т. Комай и С. Эмура . 1955. Исследование популяционной генетики полиморфной наземной улитки Bradybaena Similaris. Эволюция 9: 400–418. Google ученый

    19.

    Дж. Мюррей 1963. Наследование некоторых признаков у Cepaea hortensis и Cepaea nemoralis (Gastropoda). Генетика 48: 605–615. Google ученый

    20.

    Р.В. Мерфи, Дж. В. Сайтс-младший, Д. Г. Бут и CH Haufler . 1996. Белки: изоферментный электрофорез. В «Молекулярной систематике». Эд автор Д. М. Хиллис и К. Мориц , редакторы. Синауэр Ассошиэйтс. Сандерленд. стр. 96–116. Google ученый

    21.

    М. Ней 1972. Генетическая дистанция между популяциями. Ам Нат 106: 283–292. Google ученый

    22.

    С. Ранг 1831. Описание подвески des coquilles terrestres recueillies un voyage à la Côte occidentale d’Afrique, et au Brésil.Ann Sci Nat 24: 5–63. pl 3. Google Scholar

    23.

    Х. Рейз 1997. Deroceras juranum — менделевская цветовая морфа D. rodnae (Gastropoda: Agriolimachidae). Дж. Зул 241: 103–115. Google ученый

    24.

    К. С. Ричардс 1973. Варианты пигментации у Biomphalaria glabrata и других Planorbidae. Малакол Откр. 6:49–51. Google ученый

    25.

    К. С. Ричардс 1978 год.Генетические исследования Biomphalaria straminea: появление четвертого аллеля гена, определяющего вариации пигментации. Малакология 17: 111–115. Google ученый

    26.

    К. Секи, С. Иноуэ и Т. Асами . 2002. Географическое распространение родственных видов наземной улитки Bradybaena pellucida и B. Similaris на полуострове Босо. Венера 61: 41–48. Google ученый

    27.

    Р. К. Селандер, М.Х. Смит, С. Ю. Ян, У. Э. Джонсон и Дж. Б. Джентри . 1971. Биохимический полиморфизм и систематика рода Peromyscus. I. Изменчивость полевой мыши (Peromiscus polionotus). Стад Жене 6: 49–90. Google ученый

    28.

    Ч. Р. Шоу и Р. Прасад . 1970. Электрофорез ферментов в крахмальном геле — сборник рецептов. Биохим Гене 4: 297–320. Google ученый

    29.

    С.Ф. Штум, Т. А. Пирс и А. Вальдес . 2006. Моллюски: руководство по их изучению, сбору и сохранению. Американское малакологическое общество. Питтсбург. Google ученый

    30.

    К. Сутчарит и С. Панха . 2006. Таксономический обзор древесных улиток Amphidromus Albers, 1850 (Pulmonata: Camaenidae) в Таиланде и прилегающих районах: подрод Amphidromus. Дж. Моллус Стад 72: 1–30. Google ученый

    31.

    С.Р. Верт 1985. Внедрение изоферментной лаборатории на полевой станции. Вирджиния J Sci 36: 53–76. Google ученый

    32.

    М. Уильямсон 1959. Исследования окраски и генетики черного слизняка. Proc Roy Phys Soc Edinb 27:87–93. Google ученый

    33.

    Х. Вольда 1969. Генетика полиморфизма наземной улитки Cepaea nemoralis. Генетика 40:475–502. Google ученый

    Полногеномный анализ пресноводной улитки, передающей шистосомоз

  • Центр теоретической и эволюционной иммунологии, биология, Университет Нью-Мексико, Альбукерке, 87131, Нью-Мексико, США

    Coen M.Адема, Эрик С. Локер, Сара К. Будденборг, Милинд Мисра, Джанет Дж. Пена и Си-Мин Чжан

  • Институт генома Макдоннелла, Вашингтонский университет, Сент-Луис, 63108, Миссури, США

    ЛаДина В. Хиллер , Патрик Минкс, Сандра Клифтон, Катрина Фроник, Люсинда Фултон, Винс Магрини, Чад Томлинсон, Уэсли С. Уоррен и Ричард К. Уилсон

  • Институт биологических наук и наук об окружающей среде, Школа биологических наук, Абердинский университет, Тиллидрон-авеню , Абердин, AB24 2TZ, Великобритания

    Кэтрин С.Jones & Leslie R. Noble

  • Отделение микробиологии, иммунологии и тропической медицины и Исследовательский центр забытых болезней бедности, Школа медицины и медицинских наук, Университет Джорджа Вашингтона, Вашингтон, 20037, округ Колумбия, США

    Matty Knight & Ittiprasert Wannaporn

  • Отдел науки и математики, Университет округа Колумбия, 4200 Connecticut Avenue NW Washington, Washington, 20008, DC, USA

    Matty Knight

  • René Rachou Research Center, FIOCRUZ-Minas Research Center, FIOCRUZ Белу-Оризонти, штат Массачусетс, Бразилия

    Гильерме Оливейра, Джулиана Г.Ассис, Элио Хидео Баба, Йесид Куэста-Астроз, Сандра Г. Гава, Лиана К. Яннотти-Пассос, Вандер де Хесус Иеремиас, Фернанда Лудольф, Франсислон С. Оливейра, Фабиано С. Паис, Изинара К. Россе и Ларисса Л.С. Шольте

  • Институт технологий

    Колледж последипломного образования Каролины Морская лаборатория Холлингса Чарлстон, Чарльстон, 29412, Южная Каролина, США

    Эндрю Шедлок

  • Лаборатория биоинформатики и молекулярного анализа, Институт генетики и биохимии Федеральный университет Уберландии — Кампус Патос-де-Минас (UFU) , Патос-де-Минас, CEP 38700-128, Бразилия

    Лоуренс Родригес-ду-Амарал и Матеус де Соуза Гомес

  • Департамент жизни e Sciences, Колледж здоровья и наук о жизни, Университет Брунеля, Лондон, UB8 3PH, Аксбридж, Великобритания

    Halime D.Арикан-Гоктас и Джоанна М. Бриджер

  • Institut Sophia Agrobiotech, INRA/CNRS/UNS, София, Антиполис, Франция

    Ольга Л. Барон и Кристин Кусто

  • Департамент интегративной биологии, Орегонский государственный университет, 30029 Cordley Hall, Corvallis, 97331, Орегон, США

    Кристофер Дж. Бейн, Майкл Блуин и Джейкоб А. Теннессен

  • Факультет патобиологических наук, Университет Висконсина – Школа ветеринарной медицины, 2015 г. Линден д-р, Мэдисон, 53706, Висконсин, США

    Утибе Бикхэм-Райт, Натали Дингирард, Сяо-Джун Ву и Тимоти П.Yoshino

  • Институт биохимии и факультет биологии Карлтонского университета, Оттава, Онтарио, Канада

    Кайл К. Биггар и Кеннет Б. Стори

  • Университет штата Айова, Эймс, 00011 9005 Бори, США C. Bonning & Sijun Liu

  • Департамент информационных технологий, Гарвардская медицинская школа, 107 Avenue Louis Pasteur, Boston, 02115, Massachusetts, USA

    Chris Botka

  • Департамент иммунологии, Центр медицинских наук Sunnybrook, Университет Торонто, 2075 Бэйвью-авеню, Rm.S126, Торонто, M4N 3M5, Онтарио, Канада

    Кэтрин М. Бакли и Джонатан П. Раст

  • Laboratorio de Helmintologia e Malacologia Médica, FIOCRUZ-Minas, Исследовательский центр Рене Рашуде, Бразилия, Белу-Оризонти, Роберт

    a Lima & Омар С. Карвальо

  • Департамент генетики человека. Университет Юты, 15 Север 2030 Восток, Солт-Лейк-Сити, 84112, Юта, США

    Джулия Карлтон, Седрик Фешотт и Орели Капуста

  • Биология, Университет штата Нью-Мексико, Лас-Крусес, 88003, Нью-Мексико, США

    Мария Г.Castillo & Cesar Montelongo

  • Тема исследований в области наук о животных и микробах, IBERS, Университет Аберистуита, Аберистуит, SY23 3FG, UK

    Iain W. Chalmers, Katrin K. Geyer, Karl F. Hoffmann, 900 Umar Niaziwa555 90Martin Niaziwain

  • EMBL-EBI, Wellcome Genome Campus, CB10 1, UK

    Mikkel Christensens, Daniel Hughes и Dan Lawson

  • Univ. Перпиньян Виа Домиция, IHPE UMR 5244, CNRS, IFREMER, Univ. Montpellier, Perpignan, F-66860, France

    Celine Cosseau, David Duval, Richard Galinier, Benjamin Gourbal, Christoph Grunau, Guillaume Mitta & Titouan Quelais

  • Факультет биологии, Университет Нью-Мексико, 87131, Albuquerque , США

    Ричард М.Криппс, Тайанна Л. Ловато, Кэтрин М. Райан и Дамиан Л. Трухильо

  • Факультет науки, здравоохранения и образования, Университет Саншайн-Кост, Маручидор, 4558, Квинсленд, Австралия

    Скотт Ф. Камминс, Ди Лян , Yanin Limpanont, Bronwyn Rotgans, Tianfang Wang и Min Zhao

  • Институт медицинских исследований Уолтера и Элизы Холл 1G Royal Parade, Parkville, 3052, Виктория, Австралия

    Леон ди Стефано и Энтони Т. Папенфус

    9 0

    5

    5

    5

    5

    5

    5 Лаборатория биоинформатики и геномики рака Лоренцо и Памела Галли, научный сотрудник по исследованию меланомы Онкологический центр Питера Маккаллума Сент-Эндрюс-плейс, Восточный Мельбурн, 3002, Виктория, Австралия

    Леон ди Стефано и Энтони Т.Papenfuss

  • Основной центр геномики и биоинформатики, 19 Galvin Life Sciences, Университет Нотр-Дам, Нотр-Дам, 46556, Индиана, США

    Scott Emrich и Gloria I. Giraldo-Calderón

  • 9000 Факультет наук об окружающей среде , Копенгагенский университет, Факультет естественных наук, Thorvaldsensvej 40, Frederiksberg C, 1871, Дания

    Rene Feyereisen

  • Отдел анализа генома, Национальный институт рака, Национальные институты здравоохранения, Бетесда, 20892, Мэриленд, США

    Peter FitzGerald

  • Биологические науки, Государственный университет Боулинг-Грин, Боулинг-Грин, 43403, Огайо, США

    Майкл Гуз и Мишель А.Gordy

  • Департамент наук об общественном здравоохранении, Университет Альберты, 3-57F South Academic Building, Edmonton, T6G 1C9, Alberta, Canada

    Патрик С. Ханингтон и Эммануэль А. Пила

  • Факультет биологии, Лоуренс Университет, Эпплтон, 54911, Висконсин, США

    Джудит Хамфрис

  • Геобиологический исследовательский центр Куранта, Геттингенский университет Георга-Августа, Гольдшмидтштрассе 3, Геттинген, 37077, Германия

    Джексон

  • Институт окружающей среды, здоровья и общества, Тема окружающей среды и здоровья, Университет Брунеля, Лондон, Аксбридж, UB8 3PH, Великобритания

    Сьюзан Джоблинг, Сатвант Каур, Энн Э. Локьер и Эдвин Дж. Рутледж

  • 5
  • Департамент Биологии, Государственный университет Пенсильвании, Юниверсити-Парк, 16802, Пенсильвания, США

    Бишой Камель и Моника Медина

  • Faculteit der Aard-en Levenswetenschappen, Vrije Universiteit, De Boelelaan 1085-1087 1084 Joris 59 The Amsterdam HV000, Amsterdam HV000, Нидерланды

  • М.Koene

  • Лаборатория морской биологии Уитни, Университет Флориды, 9505 Ocean Shore Blvd, St Augustine, 32080, Флорида, США

    Андреа Б. Кон и Леонид Л. Мороз

  • Лаборатория молекулярной паразитологии Медицинские науки Фармация и химия, Кингстонский университет, Кингстон-апон-Темз, Суррей, KT1 2EE, Великобритания

    Скотт П. Лоутон и Энтони Дж. Уокер

  • Лаборатория молекулярной паразитологии, QIMR Медицинский исследовательский институт Бергхофера, Брисбен, 4006, Квинсленд, Австралия

    Дональд П.McManus

  • Кенийский институт медицинских исследований, P.O. Коробка 54840, Найроби, 00200, Кения

    Джеральд М. М.

  • Департамент нейробиологии, Пельманская школа медицины в Университете Пенсильвания, Филадельфия, 19104, Пенсильвания, США

    Michael J. Montague

  • Экологические Отдел геномики и системной биологии, Беркли Биоинформатические проекты с открытым исходным кодом, Национальная лаборатория Лоуренса Беркли, One Cyclotron Road MS 977, Беркли, 94720, Калифорния, США

    Моника С.Munoz-Torres

  • Факультет систем и вычислительной техники, Карлтонский университет, Оттава, Онтарио, Канада

    Роб Пис

  • Институт геномики, Калифорнийский университет в Санта-Круз, Калифорнийский университет в Санта-Крус, Санта-Крус, 95064, Калифорния, США

    Brian J. Raney

  • Отдел паразитов и переносчиков, Департамент наук о жизни, Лондонский центр исследований забытых тропических болезней, Биомедицинские лаборатории Wolfson Wellcome, Музей естественной истории, Cromwell Road, London, SW7 5BD, UK

    David Rollinson

  • Департамент биомедицинских наук, Факультет науки и технологий, Вестминстерский университет, 115 New Cavendish Street, London, W1W 6UW, UK

    Emanuela V.Volpi

  • Лондонский центр нанотехнологий, Университетский колледж Лондона, Gower Street, London, WC1E 6BT, UK

    Mohammed Yusuf

  • Research Complex at Harwell, Rutherford Appleton Laboratory, Oxfordshire, OX11 0FA, UK

  • CMA, ESL, MK, NR задуманное исследование, научные цели. C.M.A. руководил подготовкой проекта и рукописи при участии членов руководящего комитета M.K., C.S.J., G.O., P.M., L.W.H., A.S., E.S.L., при содействии S.E. О.К. при условии полевых собранных улиток. C.M.A. и Э.С.Л. выращивали улиток и предоставили материалы. П.М., Л.В.Х., С.К., Л.Ф., В.К.В., Р.К.В., В.М., К.Т. разработал стратегию секвенирования, руководил проектом, провел сборку и оценку. Б.Р. выполнили выравнивание генома. MC, DH, SE, GG-C. и Д.Л. выполнял построение генома, управлял метаданными, выполнял аннотацию генома и анализ данных, а также способствовал аннотации сообщества с помощью M.C.M.-T. HDА.-Г., М.Ю., Е.В.В., М.К. и Дж.М.Б. провели кариотипирование и FISH-анализ. Я.А.Т. и М.Б. выполнено сопоставление связей. Г.О., Дж.Г.А., Ю.К.-А., С.Г.Г., Ф.Л. FSO, FSP, ICR и L.L.S.S. выполнили компьютерный анализ геномных, протеомных и транскриптомных данных, содержания SNP, секретома, метаболических путей и аннотации протеинкиназ эукариот (ePK). С.Ф.К., Л.Ю., Д.Л., М.З. и Д.МакМ. проводили исследования ферорецепции. М.Т.С., К.К.Г., У.Н. и К.Ф.Х. провели бактериальный симбионтный анализ.С.Л., С.-М.З., Э.С.Л. и B.C.B. сдали анализы на вирусы. М.К., П.Ф., В.И. и Н.Р. выполнил аннотацию HSP. Т.П.И., X.-J.W., У.Б.-W. и Н.Д. провели протеогеномные исследования эмбриональных (Bge) клеток B. glabrata и паразитореактивных белков-хозяев улитки, а также анализ данных. Р.Ф., А.Э.Л. и C.S.J. выполнил аннотацию CYP. Дж. Х. выполнил аннотацию NFkB. К.М.Б. и J.P.R. проведена аннотация консервативных иммунных факторов. C.M.A. и Дж.Дж.П. выполнил аннотацию FREP. М.К.и К.М. выполнена аннотация дополнения. Д.Д. выполнена аннотация апоптоза. Б.Г. и CJB выполнили аннотацию баланса REDOX. О.Л.Б., Д.Д., Р.Г., Ч.Ц. и Г.М. проведена аннотация антибактериальной защиты. Л.д.С. и А.Т.П. провели поиск генов антибактериальной защиты. П.Ч., М.А.Г. и Е.А.П. выполнил аннотацию неизвестных новых последовательностей. K.K.G., I.W.C., U.N., K.F.H., M.T.S., Ce.C., T.Q. и К.Г. выполнили аннотацию и анализ эпигенетических последовательностей. Э.Х.Б., Л.Р. делатьА., M.de.S.G., R.L.C. и W.de.J.J. выполнили аннотацию miRNA (Бразилия), K.K.B., R.P. и K.B.S. выполнили аннотацию микроРНК (Канада). М.Г. выполнена аннотация периодичности. SFC, B.R., T.W., A.E.L. и С.К. провели нейропептидные исследования и анализ данных. А.Э.Л., Р.Ф., С.К., Э.Дж.Р., С.Дж., Д.Р., К.С.Дж. и Л.Р.Н. выполнена аннотация стероидогенеза. Дж.М.К., Б.Р. и С.Ф.К. выполнена аннотация овипостатина. А.Б.К. и Л.Л.М. выполнен анализ локализации транскриптов в тканях. А.Дж.В.и С.П.Л. проведена аннотация фосфатаз. Т.Л.Л., К.М.Р., М.Ми. и Р.К. выполнили аннотацию актинов и аннотацию сердечной транскрипционной программы с помощью D.L.T. Д.Дж.Дж., Б.К. и М.Ме. проведена аннотация генов биоминерализации. Дж.К., А.К. и К.Ф. выполнили аннотацию транспозонов ДНК, глобальный анализ ландшафта мобильных элементов и событий горизонтального переноса. A.S. и CB выполнили повторный/TE-анализ. Э.С.Л., С.М.З., Г.М.М. и С.К.Б. провели сравнительные исследования транскриптома B. pfeifferi и анализ данных.C.M.A., написал большую часть текстов вместе с P.M., M.L.M. и вклады всех авторов.

    CYMATIUM RANZANII — (Bianconi, 1850)

    Cymatium ranzanii – вид хищных морских улиток, морских брюхоногих моллюсков семейства Ranellidae, улиток-тритонов, раковин тритонов или тритонов.

    Синоним
    Triton ranzanii (Bianconi, 1850)

    Выдержка из «Новитате Американского музея — номер 2108 — 10.10.1962».
    http://digitallibrary.amnh.org/dspace/bitstream/handle/2246/3407/N2108.pdf?sequence=1

    Triton ranzanii был описан Бьянкони из «le canal de Mosambique» (1850, 1851a, 1851b, 1851c). Бьянкони сравнил свой вид с Triton femorale (Linne) из Вест-Индии. Последующие студенты группы лишь вскользь упомянули Triton ranzanii. Kiister и Kobelt (1878) рассмотрели Purpuracea и поместили этот таксон в список видов inquirendae. В монографии семейства Tritonidae Триона (1881, табл. 10, илл. 71) одна из фигур Бьянкони (Bianconi, 1851а; 1851б, илл.1) был воспроизведен, и этот таксон был включен в синоним Triton (Cymatium) tigrinus Broderip из тропической восточной части Тихого океана. Байер (1933) перечислил Cymatium (Cymatium) ranzanii как разновидность Cymatium (Cymatium) tigrinum (Broderip) в своем каталоге Cymatiidae в Рейкс-музее в Лейдене. Смит (1944, стр. 22, рис. 270) представил Триону репродукцию иллюстрации Бьянкони и вслед за Трионом отнес рисунок к Cymatium tigrinum (Broderip). Смит (1948) не упомянул Cymatium ranzanii в своем обзоре семейства Cymatiidae, а Франка (1960) не указала этот вид в своем списке моллюсков, собранных на острове Инхака, Мозамбик.Образцы этого вида, по-видимому, не были доступны этим рабочим, и валидность этого вида остается под вопросом до настоящего времени. Наш поиск образцов Cymatium ranzanii в конхологических коллекциях крупных музеев восточной части Соединенных Штатов показал следующее: один образец, по которому отсутствуют определенные данные о местонахождении, присутствует в старой коллекции Д. Дж. Стюарда Американского музея естественной истории; и единичные экземпляры были недавно получены Музеем сравнительной зоологии Гарвардского колледжа из Сомалиленда [Республика Сомали] и Национальным музеем США из близ Карачи, Пакистан.Недавно Американский музей естественной истории получил два фрагментарных экземпляра из Маската, Омана, Аравии. Эти пять экземпляров, по-видимому, являются единственными представителями этого вида, присутствующими в настоящее время в коллекциях этих учреждений, и все экземпляры, кроме одного, были получены в течение последних пяти лет. После определения редкости этого вида мы запросили дополнительную информацию у Гроша. Он любезно прислал нам на время еще два экземпляра и предоставил следующие полевые заметки: «Первый из немногих экземпляров, три собранных живыми и один или два мертвых, я нашел в марте или апреле 1953 года.Его размер составлял 204 мм. Еще один образец меньшего размера был обнаружен в 1957 году, а третий — в 1958 году. Все, включая один или два мертвых экземпляра, были обнаружены в одном и том же районе. Этот район находится в северо-восточном углу полуострова Кабасейра, который отделяет залив Мозамбик от залива Кондусия, примерно в 200 метрах от берега и примерно на 6-10 метров ниже уровня отлива. Район имеет террасированное гравийное дно, покрытое водорослями и усеянное крупными изолированными коралловыми валунами. Все образцы были собраны примерно во время мартовских весенних приливов между 1953-1959 годами.«По сравнению с известными ныне живущими видами Cymatium мало сомнений в том, что Cymatium ranzanii наиболее тесно связан с Cymatium tigrinum (Broderip) панамской фаунистической провинции и Cymatiumfemorale (Linne) карибской фауны (см. рис. 3, 4). Эти три вида образуют группу с очевидным сходством признаков раковины и относятся к Cymatium, sensu stricto. : Протеины моллюсков.Комптес Рендус Палевол. 2004, 3: 469-492. 10.1016/j.crpv.2004.07.009.

    Артикул Google ученый

  • Wilt FH: Биология развития встречается с материаловедением: Морфогенез биоминерализованных структур. Дев биол. 2005, 280: 15-25. 10.1016/j.ydbio.2005.01.019.

    КАС пабмед Статья Google ученый

  • Wilt FH, Killian CE, Livingston BT: Развитие известковых элементов скелета у беспозвоночных.Дифференциация. 2003, 71: 237-250. 10.1046/j.1432-0436.2003.7104501.х.

    КАС пабмед Статья Google ученый

  • Jackson DJ, McDougall C, Green KM, Simpson F, Wörheide G, Degnan BM: Быстро развивающийся секретом строит и моделирует морскую раковину. БМС Биол. 2006, 4: 40-10.1186/1741-7007-4-40.

    Центральный пабмед пабмед Статья Google ученый

  • Манн К., Эдсингер-Гонсалес Э., Манн М. Углубленный протеомный анализ раковины моллюска: кислоторастворимый и кислотонерастворимый матрикс блюдца Lottia gigantea .Proc Natl Acad Sci U S A. 2012, 10: 28-

    CAS Google ученый

  • Marie B, Marie A, Jackson DJ, DuBost L, Degnan BM, Milet C, Marin F: Протеомный анализ кальцинированного органического матрикса тропического морского ушка Haliotis asinina shell. Proc Natl Acad Sci U S A. 2010, 8: 54-

    CAS Google ученый

  • Zhang G, Fang X, Guo X, Li L, Luo R, Xu F, Yang P, Zhang L, Wang X, Qi H, Xiong Z, Que H, Xie Y, Holland PWH, Paps J, Zhu Y, Wu F, Chen Y, Wang J, Peng C, Meng J, Yang L, Liu J, Wen B, Zhang N, Huang Z, Zhu Q, Feng Y, Mount A, Hedgecock D и др.: Геном устрицы выявляет стресс-адаптацию и сложность формирования раковин.Природа. 2012, 490: 49-54. 10.1038/природа11413.

    КАС пабмед Статья Google ученый

  • Амос Ф.Ф., Понсе С.Б., Эванс Дж.С.: Формирование надмолекулярных сборок каркасных полипептидов перламутра, которые зародышеобразуют полиморфы. Биомакромолекулы. 2011, 12: 1883-1890. 10.1021/бм200231с.

    КАС пабмед Статья Google ученый

  • Montagnani C, Marie B, Marin F, Belliard C, Riquet F, Tayalé A, Zanella-Cléon I, Fleury E, Gueguen Y, Piquemal D, Cochennec-Laureau N: Pmarg-pearlin представляет собой матричный белок, участвующий в Формирование каркаса перламутра у жемчужной устрицы Pinctada margaritifera.Химбиохим. 2011 г., doi:10.1002/cbic.201100216

    Google ученый

  • Shen X, Belcher AMB, Hansma PK, Stucky GD, Morse DEM: Молекулярное клонирование и характеристика Lustrin A, матричного белка из раковины и жемчужного перламутра Haliotis rufescens . Дж. Биол. Хим. 1997, 272: 32472-32481. 10.1074/jbc.272.51.32472.

    КАС пабмед Статья Google ученый

  • Suzuki M, Saruwatari K, Kogure T, Yamamoto Y, Nishimura T, Kato T, Nagasawa H: Белок кислого матрикса, Pif, является ключевой макромолекулой для образования перламутра.Наука. 2009, 325: 781-908.

    Google ученый

  • Пават С., Занелла-Клеон И., Бекки М., Медакович Д., Люке Г., Гишар Н., Алькарас Г., Доммерг Ж.Л., Серпентини А., Лебель Ж.М.: Матрица раковины легочной наземной улитки Helix aspersa maxima . Comp Biochem Physiol B. 2012, 161: 303-314. 10.1016/j.cbpb.2011.12.003.

    КАС пабмед Статья Google ученый

  • Fisher R, Diver C: Crossing-over in the Land Snail Cepea nemoralis , L.Природа. 1934, 133: 834-835.

    Артикул Google ученый

  • Язык A: Fortgesetzte Vererbungsstudien. Мол Ген Жене. 1911, 5: 97-138. 10.1007/BF01798017.

    Артикул Google ученый

  • Язык A: Vererbungswissenschaftliche Miszellen. Мол Ген Жене. 1912, 8: 233-283. 10.1007/BF01835489.

    Артикул Google ученый

  • Каин А.Дж., Кинг Дж., Шеппард П.: Новые данные о генетике полиморфизма у улитки Cepaea nemoralis L.Генетика. 1960, 45: 393-411.

    КАС ПабМед Центральный пабмед Google ученый

  • Кук Л. Генетика Cepaea nemoralis . Наследственность. 1967, 22: 397-410. 10.1038/hdy.1967.49.

    Артикул Google ученый

  • Каин А.Дж., Шеппард П.М.: Естественный отбор в Cepaea . Генетика. 1954, 39: 89-116.

    КАС ПабМед Центральный пабмед Google ученый

  • Сурмацкий А., Ожаровска-Новицка А., Канифоль З.М. Полиморфизм окраски наземной улитки Cepaea nemoralis (Pulmonata: Helicidae) глазами потенциальных хищников-птиц.Натурвиссеншафтен. 2013, 100: 1-8. 10.1007/s00114-012-1000-7.

    Артикул Google ученый

  • Джонс Дж.С., Лейт Б., Роулингс П.: Полиморфизм в Cepaea : проблема со слишком большим количеством решений?. Annu Rev Ecol Syst. 1977, 8: 109-143. 10.1146/аннурев.эс.08.110177.000545.

    Артикул Google ученый

  • Ричардс П.М., Лю М.М., Лоу Н., Дэйви Дж.В., Блакстер М.Л., Дэвисон А.: Маркеры, полученные с помощью RAD-Seq, обрамляют цвет раковины и локусы полос супергена Cepaea nemoralis .Мол Экол. 2013, 22: 3077-3089. 10.1111/меч.12262.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Comfort AC: Пигментация раковин моллюсков. Biol Rev. 1951, 26: 285-301.

    КАС Статья Google ученый

  • Gysi JR, Chapman DJ: Сравнительная биохимия Haliotis пигментация: необычные билипептиды Haliotis cracherodii .Comp Biochem Physiol B. 1979, 63B: 355-361.

    КАС Google ученый

  • Hedegaard C, Bardeau JF, Chateigner D: Пигменты раковин моллюсков: in situ резонансное рамановское исследование. J моллюск завод. 2006, 72: 157-162. 10.1093/моллюс/eyi062.

    Артикул Google ученый

  • Koizumi C, Nonaka J: Желтые пигменты жемчуга — I. Каротиноидный пигмент в желтом перламутре.Bull Jap Soc Sci Fish. 1970, 36: 1054-1058. 10.2331/суисан.36.1054.

    КАС Статья Google ученый

  • Рамос-Сильва П., Марин Ф., Каандорп Дж., Мари Б. Инструментарий биоминерализации: важность очистки образцов перед характеристикой биоминеральных протеомов. Proc Natl Acad Sci U S A. 2013, 110: E2144-E2146. 10.1073/пнас.1303657110.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Дрейк Дж.Л., Масс Т., Харамати Л., Зелцион Э., Бхаттачарья Д., Фальковски П.Г.: Протеомный анализ скелетной органической матрицы каменистого коралла Stylophora pistillata .Proc Natl Acad Sci USA. 2013, 110: 3788-3793. 10.1073/пнас.1301419110.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Shur I, Socher R, Hameiri M, Fried A, Benayahu D: Молекулярная и клеточная характеристика SEL OB/SVEP1 в остеогенных клетках in vivo и in vitro. J Cell Physiol. 2006, 206: 420-427. 10.1002/jcp.20497.

    КАС пабмед Статья Google ученый

  • Джексон Д.Дж., Макдугал С., Вудкрофт Б., Моас П., Роуз Р.А., Кубе М., Рейнхардт Р., Рохсар Д.С., Монтаньяни С., Жубер С., Пикемаль Д., Дегнан Б.М.: Параллельная эволюция наборов генов, образующих перламутр, у моллюсков.Мол Биол Эвол. 2010, 27: 591-608. 10.1093/молбев/msp278.

    КАС пабмед Статья Google ученый

  • Marie B, Joubert C, Tayale A, Zanella-Cleon I, Belliard C, Piquemal D, Cochennec-Laureau N, Marin F, Gueguen Y, Montagnani C: различные секреторные репертуары контролируют процессы биоминерализации призмы и отложения перламутра раковины жемчужной устрицы. Proc Natl Acad Sci U S A. 2012, 109: 20986-20991. 10.1073/пнас.1210552109.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Gaume B, Denis F, Van Wormhoudt A, Huchette S, Jackson DJ, Avignon S, Auzoux-Bordenave S: Характеристика и экспрессия биоминерализующего гена Lustrin A во время формирования раковины европейского морского ушка Haliotis tuberculata . Comp Biochem Physiol B. 2014, 169: 1-8.

    КАС пабмед Статья Google ученый

  • Ранганатан С., Симпсон К.Дж., Шоу Д.К., Николас К.Р.: Семейство сывороточных кислых белков: новый характерный мотив и трехмерная структура путем сравнительного моделирования.Графовая модель J-Mol. 1999, 17: 106-113. 10.1016/S1093-3263(99)00023-6. 134

    КАС пабмед Статья Google ученый

  • Мари Б., Джексон Д.Дж., Занелла-Клеон И., Рамос-Сильва П., Гишар Н., Марин Ф.: Протеом, образующий раковину Lottia gigantea , обнаруживает как глубокую консервацию, так и специфичные для линии новшества. ФЕБС Дж. 2013, 280: 214-232. 10.1111/февраль 12062.

    КАС пабмед Статья Google ученый

  • Кабат А.Р.: Хищная экология натицидных брюхоногих моллюсков с обзором хищничества в раковинах.Мал Инт Джей Малак. 1990, 32: 155-193.

    Google ученый

  • Касерес-Мартинес Дж., Масиас-Монтес-де-Ока П., Васкес-Йоманс Р.: Polydora sp. заражение и здоровье тихоокеанской устрицы Crassostrea gigas , выращенной в Нижней Калифорнии, на северо-западе Мексики. Дж Шелл Рез. 1998, 17: 259-264.

    Google ученый

  • Le Cam S, Viard F: Заражение инвазивным моллюском Crepidula fornicata местным моллюском Cliona celata : случай высокой паразитарной нагрузки без пагубных последствий.Биол Инв. 2011, 13: 1087-1098. 10.1007/s10530-011-9958-1.

    Артикул Google ученый

  • Herrmann H, Bär H, Kreplak L, Strelkov SV, Aebi U: Промежуточные филаменты: от клеточной архитектуры к наномеханике. Nat Rev Mol Cell Biol. 2007, 8: 562-573. 10.1038/nrm2197.

    КАС пабмед Статья Google ученый

  • Qin Z, Kreplak L, Buehler MJ: Иерархическая структура контролирует наномеханические свойства промежуточных филаментов виментина.ПЛОС Один. 2009, 4: e7294-10.1371/journal.pone.0007294.

    Центральный пабмед пабмед Статья Google ученый

  • Креплак Л., Фадж Д. Биомеханические свойства промежуточных филаментов: от тканей к одиночным филаментам и обратно. Биоэссе. 2007, 29: 26-35. 10.1002/бис.20514.

    КАС пабмед Статья Google ученый

  • Марксен Дж. К., Нимц М., Беккер В., Манн К.: основные растворимые 19.Белок 6 кДа органического матрикса раковины пресноводной улитки Biomphalaria glabrata представляет собой N-гликозилированный дермапонтин. Биохим Биофиз Акта. 2003, 1650: 92-98. 10.1016/С1570-9639(03)00203-6.

    КАС пабмед Статья Google ученый

  • Marxen JC, Becker W: Органическая матрица раковины пресноводной улитки Biomphalaria glabrata . Comp Biochem Physiol B. 1997, 118: 23-33.

    Артикул Google ученый

  • Сарашина И., Ямагути Х., Хага Т., Иидзима М., Чиба С., Эндо К.: Молекулярная эволюция и функционально важные структуры дермапонтина моллюска: значение для происхождения белков матрикса оболочки моллюска.Дж Мол Эвол. 2006, 62: 307-318. 10.1007/s00239-005-0095-2.

    КАС пабмед Статья Google ученый

  • Jiao Y, Wang H, Du X, Zhao X, Wang Q, Huang R, Deng Y: Дермапонтин, ген матриксного белка раковины Pearl Oyster Pinctada Martensii , участвует в формировании перламутра. Biochem Biophys Res Commun. 2012, 425: 679-683. 10.1016/j.bbrc.2012.07.099.

    КАС пабмед Статья Google ученый

  • Финн Р.Д., Клементс Дж., Эдди С.Р.: Веб-сервер HMMER: интерактивный поиск сходства последовательностей.Нуклеиновые Кислоты Res. 2011, 39: W29-W37. 10.1093/нар/гкр367.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Ramos-Silva P, Kaandorp J, Huisman L, Marie B, Zanella-Cléon I, Guichard N, Miller DJ, Marin F: Скелетный протеом коралла Acropora millepora : эволюция кальцификации путем кооптации и перетасовка домена. Мол Биол Эвол. 2013

    Google ученый

  • Манн К., Пустка А.Дж., Манн М.: Углубленная высокоточная протеомика матрицы зубов морского ежа.Proc Natl Acad Sci U S A. 2008, 6: 33-

    Google ученый

  • Манн К., Пустка А.Дж., Манн М.: Тесты морского ежа ( Strongylocentrotus purpuratus ) и протеомы позвоночника. Proc Natl Acad Sci U S A. 2008, 6: 22-

    Google ученый

  • Петерс В.: Наличие хитина у моллюсков. Comp Biochem Physiol B. 1972, 41: 541-550.

    КАС Google ученый

  • Weiss I, Schönitzer V, Eichner N, Sumper M: Хитинсинтаза, участвующая в формировании раковин морских двустворчатых моллюсков, содержит миозиновый домен.ФЭБС лат. 2006, 580: 1846-1852. 10.1016/j.febslet.2006.02.044.

    КАС пабмед Статья Google ученый

  • Эрлих Х., Калужная О.В., Цуркан М.В., Ересковский А., Табачник К.Р., Илан М., Стеллинг А., Галли Р., Петрова О.В., Некипелов С.В.: Первое сообщение о хитиновой фиксации у губок (Porifera). Proc R Soc B. 2013, 280: 20130339-10.1098/rspb.2013.0339.

    Центральный пабмед пабмед Статья Google ученый

  • Брюнет PCJ, Карлайл Д.Б.: Хитин у погонофор.Природа. 1958, 182: 1689-

    КАС Статья Google ученый

  • Фалини Г., Фермани С.: Хитиновая минерализация. Ткань англ. 2004, 10: 1-6. 10.1089/1076327043227.

    КАС пабмед Статья Google ученый

  • Takano Y, Ozawa H, Crenshaw MA: активность Ca-ATPase и ALPase в начальных участках кальцификации дентина и эмали в резце крысы.Сотовые Ткани Res. 1986, 243: 91-99.

    КАС пабмед Статья Google ученый

  • Тамбутте Э., Аллеманд Д., Мюллер Э., Жобер Дж.: Детальный подход к изучению механизма кальцификации герматипных кораллов. J Эксперт Биол. 1996, 199: 1029-1041.

    Google ученый

  • Roer RD: Механизмы резорбции и отложения кальция в панцире краба Carcinus Maenas .J Эксперт Биол. 1980, 88: 205-218.

    КАС Google ученый

  • Миямото Х., Яно М., Мияшита Т. Сходства в структуре накреина, белка матрикса раковины, у двустворчатых моллюсков и брюхоногих моллюсков. J моллюск завод. 2003, 69: 87-89. 10.1093/моллюс/69.1.87.

    Артикул Google ученый

  • Миямото Х., Мияшита Т., Окусима М., Накано С., Морита Т., Мацусиро А. Карбоангидраза из перламутрового слоя устричных жемчужин.Proc Natl Acad Sci U S A. 1996, 93: 9657-9660. 10.1073/пнас.93.18.9657.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Miyamoto H, Miyoshi F, Kohno J: Белок домена карбоангидразы накреин экспрессируется в эпителиальных клетках мантии и действует как негативный регулятор кальцификации у моллюска Pinctada fucata . Зоол науч. 2005, 22: 311-315. 10.2108/зсж.22.311.

    КАС пабмед Статья Google ученый

  • Edgar RC: Поиск и кластеризация на несколько порядков быстрее, чем BLAST.Биоинформатика. 2010, 26: 2460-2461. 10.1093/биоинформатика/btq461.

    КАС пабмед Статья Google ученый

  • Wisniewski JR, Zougman A, Nagaraj N, Mann M: Универсальный метод подготовки образцов для анализа протеома. Нат Мет. 2009, 6: 359-362. 10.1038/nmeth.1322.

    КАС Статья Google ученый

  • Rappsilber J, Mann M, Ishihama Y: Протокол микроочистки, обогащения, предварительного фракционирования и хранения пептидов для протеомики с использованием StageTips.Нат Проток. 2007, 2: 1896-1906. 10.1038/нпрот.2007.261.

    КАС пабмед Статья Google ученый

  • Михальски А., Дамок Э., Ланге О., Денисов Э., Нолтинг Д., Мюллер М., Винер Р., Шварц Дж., Ремес П., Белфорд М., Дуняч Дж.Дж., Кокс Дж., Хорнинг С., Манн М., Макаров А.: Ультра Масс-спектрометр Orbitrap с линейной ионной ловушкой высокого разрешения (Orbitrap Elite) позволяет использовать ЖХ-МС/МС сверху вниз и универсальные режимы фрагментации пептидов. Мол клеточная протеомика.2012, 11: О111.013698-10.1074/мкп.О111.013698.

    Центральный пабмед пабмед Статья Google ученый

  • Schwanhausser B, Busse D, Li N, Dittmar G, Schuchhardt J, Wolf J, Chen W, Selbach M: Глобальная количественная оценка контроля экспрессии генов млекопитающих. Природа. 2011, 473: 337-342. 10.1038/природа10098.

    ПабМед Статья Google ученый

  • Cox J, Mann M: MaxQuant обеспечивает высокую скорость идентификации пептидов, индивидуализированная с.Точность массы pb-диапазона и количественная оценка белка по всему протеому. Нац биотехнолог. 2008, 26: 1367-1372. 10.1038/нбт.1511.

    КАС пабмед Статья Google ученый

  • Cox J, Matic I, Hilger M, Nagaraj N, Selbach M, Olsen JV, Mann M: Практическое руководство по вычислительной платформе MaxQuant для количественной протеомики на основе SILAC. Нат Проток. 2009, 4: 698-705. 10.1038/нпрот.2009.36.

    КАС пабмед Статья Google ученый

  • Кокс Дж., Нойхаузер Н., Михальски А., Шелтема Р.А., Олсен Дж.В., Манн М.: Андромеда: поисковая система пептидов, интегрированная в среду MaxQuant.Дж Протеом Рез. 2011, 10: 1794-1805. 10.1021/пр101065ж.

    КАС Статья Google ученый

  • Нойхаузер Н., Михальски А., Кокс Дж., Манн М.: Экспертная система для компьютерной аннотации спектров МС/МС. Мол клеточная протеомика. 2012, 11: 1500-1509. 10.1074/мкп.М112.020271.

    Центральный пабмед пабмед Статья Google ученый

  • Goujon M, McWilliam H, Li W, Valentin F, Squizzato S, Paern J, Lopez R: Новая структура инструментов анализа биоинформатики в EMBL-EBI.Нуклеиновые Кислоты Res. 2010, 38: W695-W699. 10.1093/нар/gkq313.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Soding J, Thompson JD, Higgins DG: Быстрое, масштабируемое производство высококачественных протеиновых множеств выравнивание последовательностей с использованием Clustal Omega. Мол Сист Биол. 2011, 7: 539-

    PubMed Central пабмед Статья Google ученый

  • Хантер С., Джонс П., Митчелл А., Апвейлер Р., Эттвуд Т.К., Бейтман А., Бернард Т., Биннс Д., Борк П., Бердж С., де Кастро Э., Коггилл П., Корбетт М., Дас У., Догерти Л., Дюкенн Л., Финн Р.Д., Фрейзер М., Гоф Дж., Хафт Д., Хуло Н., Кан Д., Келли Э., Летуник И., Лонсдейл Д., Лопес Р., Мадера М., Маслен Дж., Маканулла С., МакДауэлл Дж. и др.: InterPro в 2011: новые разработки в базе данных прогнозирования семейств и доменов.Нуклеиновые Кислоты Res. 2012, 40: Д306-Д312. 10.1093/нар/гкр948.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Petersen TN, Brunak S, von Heijne G, Nielsen H: SignalP 4.0: выделение сигнальных пептидов из трансмембранных областей. Нат Мет. 2011, 8 (10): 785-786. 10.1038/nmeth.1701.

    КАС Статья Google ученый

  • Darzentas N: Circoletto: визуализация сходства последовательностей с Circos.Биоинформатика. 2010, 26: 2620-2621. 10.1093/биоинформатика/btq484.

    КАС пабмед Статья Google ученый

  • Крживински М., Шейн Дж., Бироль И., Коннорс Дж., Гаскойн Р., Хорсман Д., Джонс С.Дж., Марра М.А.: Циркос: информационная эстетика для сравнительной геномики. Геном Res. 2009, 19: 1639-1645. 10.1101/гр.092759.109.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • (PDF) Экология популяции улитки Melampus bidentatus в изменяющихся ландшафтах солончаков

    16 из 17 

    |

         ZAJAC et Al.

    Доннелли, Дж., и Бертнесс, М. (2001). Быстрое продвижение к берегу солончака

    болотной травы в ответ на ускоренное повышение уровня моря. Proceedings

    of the National Academy of Sciences, 98, 14218.

    Fell, P., Murphy, K., Peck, M., & Recchia, M. (1991). Восстановление

    Melampus bidentatus (Say) и других макробеспозвоночных на восстановленном

    запруженном приливном болоте: сравнение популяций выше и ниже

    дамбы водохранилища.Журнал экспериментальной морской биологии и экологии

    , 152, 33–48.

    Фелл П., Олмстед Н., Карлсон Э., Джейкоб В., Хичкок Д. и Силбер Г.

    (1982). Распространение и численность макробеспозвоночных на некоторых приливных болотах Коннектикута с акцентом на доминирующих моллюсках.

    Эстуарии и побережья, 5, 234–239.

    Фелл П. и Уильямс Дж. (1985). Распределение улиток Melampus bidentatus

    tus и мидий Geukensia demissa вдоль эстуария Патагуансет

    (Коннектикут) в зависимости от солености и других беспозвоночных приливных болот.

    The Nautilus (Филадельфия, Пенсильвания), 99, 21–28.

    Фраско, Б.А., и Гуд, Р.Э. (1982). Динамика разложения Spartina

    alterniflora и Spartina patens в солончаке Нью-Джерси. American

    Журнал ботаники, 69, 402–406.

    Гедан, К.Б., Альтьери, А.Х., и Бертнесс, М.Д. (2011). Неопределенное будущее

    солончаков Новой Англии. Серия «Прогресс морской экологии», 434,

    229–237.

    Гедан, К., Силлиман, Б.и Бертнесс, М. (2009). Столетия антропогенных

    изменений в экосистемах солончаков. Ежегодный обзор морской науки, 1,

    117–141.

    Граса, Массачусетс, Ньюэлл, С.Ю., и Кнайб, Р.Т. (2000). Скорость выедания органического вещества и биомассы живых грибов разлагающейся Spartina alterniflora

    тремя видами солончаковых беспозвоночных. Морская биология, 136,

    281–289.

    Халупа, П.Дж., и Хоус, Б. (1995). Влияние влажности подстилки

    на разложение Spartina alterniflora и S.патенты Морской пехотинец

    Биология, 123, 379–391.

    Хартиг, Э. К., Горниц, В., Колкер, А., Мушаке, Ф., и Фэллон, Д. (2002).

    Антропогенное и климатическое воздействие на солончаки Ямайки

    Бей, г. Нью-Йорк. Водно-болотные угодья, 22, 71–89.

    Хаусман, С. (1932). Вклад в экологию солончака,

    Melampus bidentatus Say. Американский натуралист, 66, 541–545.

    Хитч А. Т., Перселл К. М., Мартин С.Б., Клеркс, П.Л., и Леберг, П.Л. (2011).

    Взаимодействие засоления, фрагментации болот и затопленной водной

    растительности на резидентных нектонных комплексах прибрежных болотных прудов.

    Эстуарии и побережья, 34, 653–662.

    Холдридж, К., Бертнесс, М., и Алтьери, А. (2009). Роль травоядных крабов в гибели солончаков Новой Англии. Биология сохранения, 23,

    672–679.

    Хьюз Р. и Парамор О. (2004).Об утрате солончаков на юго-востоке

    Англии и методах их восстановления. Журнал прикладной экологии,

    41, 440–448.

    Хатченс, Дж. Дж. Младший, и Уолтерс, К. (2006). Численность и биомасса брюхоногих моллюсков

    взаимосвязь с растительностью солончаков в южной части

    эстуариев Каролины, США, где преобладает океан. Журнал исследований моллюсков, 25, 947–953.

    Джойс, А., и Вайсберг, С. (1986). Последствия хищничества мумихога,

    Fundulus heteroclitus (L.), по численности и распространению соляной

    болотной улитки, Melampus bidentatus (Say). Journal of Experimental Marine

    Biology and Ecology, 100, 295–306.

    Кервин, Дж. (1972). Распространение солончака (Melampus bidentatus

    Say) по отношению к болотным растениям в районе реки Поропотанк, Вирджиния.

    Chesapeake Science, 13, 150–153.

    Кирван М.Л., Гунтеншперген Г.Р., Д’Альпаос А., Моррис Дж.Т., Мадд С.М.,

    и Теммерман С.(2010). Пределы приспособляемости прибрежных болот

    к повышению уровня моря. Письма о геофизических исследованиях, 37, L23401.

    Кирван, М.Л., и Мюррей, А.Б. (2008). Приливные болота как неравновесные ландшафты —

    пейзажей? Лаги между морфологией и изменением уровня моря в голоцене.

    Письма о геофизических исследованиях, 35, L24401.

    Кирван, М.Л., Мюррей, А.Б., Доннелли, Дж.П., и Корбетт, Д.Р. (2011). Быстрое

    расширение водно-болотных угодий во время европейского заселения и его последствия для

    выживания болот при современных скоростях поступления наносов.Геологии, 39,

    507–510.

    Кирван, М., и Теммерман, С. (2009). Реакция прибрежных болот на историческое и будущее повышение уровня моря. Quaternary Science Reviews, 28,

    1801–1808.

    Ли, С., и Силлиман, Б. (2006). Конкурсное вытеснение детритоядной

    солончаковой улитки. Журнал экспериментальной морской биологии и экологии, 339,

    75–85.

    Лук, Ю. К., и Заяц, Р. Н. (2013). Пространственная экология крабов-скрипачей, Uca pugnax,

    в ландшафтах солончаков на юге Новой Англии: потенциальное расширение местообитаний

    в связи с изменением солончаков.Северо-восточный натуралист, 20,

    255–274.

    МакМахон, Р., и Рассел-Хантер, В. (1981). Влияние физических факторов и акклиматизации на выживаемость и потребление кислорода высоко

    прибрежной солончаковой улитки Melampus bidentatus Say. Биологический бюллетень,

    161, 246–269.

    Мюррей, А., Кнаапен, М., Тал, М., и Кирван, М. (2008). Биоморфодинамика:

    физико-биологические обратные связи, формирующие ландшафты.Водные ресурсы

    Research, 44, W11301.

    Орсон, Р. А. (1999). Палеоэкологическая оценка Phragmites australis

    в приливных болотах Новой Англии: изменения в структуре растительного сообщества

    за последние несколько тысячелетий. Биологические вторжения, 1, 149–158. (2015). Повышение уровня моря и убежище для обитателей приливных болот: могут ли искусственные острова спасти железную дорогу Калифорнийского Риджуэя? Экологический

    Машиностроение, 74, 337–344.

    Прайс, К. (1980). Водные отношения и физиологическая экология солончака

    Улитка Melampus bidentatus Say. Журнал экспериментальной морской биологии

    и экологии, 45, 51–67.

    Прайс, CH (1984). Приливные миграции литоральной солончаковой улитки Melampus

    bidentatus Say. Журнал экспериментальной морской биологии и экологии, 78,

    111–126.

    Рапоза, К.Б., Вебер, Р.Л.Дж., Экберг, М.К., и Фергюсон, В. (2015).

    Динамика растительности на солончаках Род-Айленда в период

    ускоренного повышения уровня моря и экстремальных явлений, связанных с уровнем моря. Эстуарии и

    Берега. doi:10.1007/s12237-015-0018-4

    Рид, Д. Дж. (2006). Реакция прибрежных болот на повышение уровня моря:

    выживание или затопление? Процессы и формы рельефа поверхности Земли, 20,

    39–48.

    Рейс С.Р. и Стивен А.Е. (1983). Мозаичность окружающей среды, разложение подстилки и связанная с этим структура фауны на болоте Spartina alterniflora.

    Устье рек, прибрежная и шельфовая наука, 16, 559–571.

    Риетсма, К.С., Валиела, И., и Буксбаум, Р. (1988). Химия детрита, рост

    и выбор пищи у солончака (Melampus bidentatus).

    Экология, 69, 261–266.

    Риетсма, К., Валиела, И., и Сильвестр-Серианни, А. (1982). Пищевые предпочтения

    доминирующих травоядных и детритофагов солончаков. Морская экология, 3,

    179–189.

    Розенберг, М.С. и Андерсон, CD (2011). ПРОХОД: Анализ закономерностей,

    Пространственная статистика и географическая экзегеза. Версия 2. Методы

    Экология и эволюция, 2, 229–232.

    Рассел-Хантер, В., Эпли, М., и Хантер, Р. (1972). История ранней жизни

    Мелампа и значение полулунной синхронии. The Biological

    Bulletin, 143, 623.

    Smith, SM (2009). Многолетние изменения в солончаках Кейп-Код,

    Массачусетс: фотографический анализ утраты растительности, смены видов и геоморфологических изменений.Северо-восточный натуралист, 16, 183–208.

    Смит, С. М. (2015a). Улучшает ли утрата солончаковой растительности, вызванная местным крабом-грапсидом

    , пригодность среды обитания для атлантического грязевого скрипача (Uca

    pugnax)? Журнал биологии ракообразных, 35, 616–621.

    Смит, С. М. (2015b). Изменение растительности на солончаках Кейп-Код

    National Seashore (Массачусетс, США) в период с 1984 по 2013 год.

    Wetlands, 35, 127–136.

    Смит, С. М., Медейрос, KC, и Tyrrell, MC (2012). Гидрология, травоядность и упадок Spartina patens (Aiton) Muhl. во внешнем Кейп-Код

    Тканеспецифическая оценка подходящих эталонных генов для RT-qPCR у прудовика, Lymnaea stagnalis [PeerJ]

    Фон

    Lymnaea stagnalis — пресноводная улитка с обширной историей изучения непосредственных механизмов. Предыдущие исследования в основном были сосредоточены на его нейробиологии, а также эндокринологии, иммунологии и морфологии оболочки (Chase, 2002; Benjamin, 2008).Центральная нервная система (ЦНС) относительно проста и насчитывает около 20 000 нейронов, многие из которых крупные и легко идентифицируемые, что делает их подходящими для изучения обучения, памяти, генерации двигательных паттернов, регенерации нейронов и образования синапсов (Lukowiak, 2016; Elliott & Susswein, 2002; Chase, 2002; Lukowiak et al., 2003; Getz et al., 2018). Параллельные исследования нейроэндокринной (Koene, 2010; Pirger et al., 2010) и иммунной (Van Der Knaap, Adema & Sminia, 1993; Gust et al., 2013a) системы L. stagnalis и других брюхоногих моллюсков улучшили наше понимание репродуктивного поведения, иммунитета и токсикологии L. stagnalis . Кроме того, L. stagnalis использовался в качестве исследовательского организма для изучения молекулярных механизмов, управляющих формированием скорлупы (Boer & Witteveen, 1980; Ebanks, O’Donnell & Grosell, 2010; Hohagen & Jackson, 2013; Jackson, Herlitze & Hohagen, 2016; Herlitze et al., 2018). Совсем недавно л.stagnalis также использовался для изучения молекулярной основы асимметрии тела (Davison et al., 2016; Abe & Kuroda, 2019).

    В прошлых исследованиях использовался широкий спектр традиционных методов, но современная молекулярная генетика еще не была полностью включена в изучение L. stagnalis . Методы изучения генетики L. stagnalis , такие как количественная ПЦР с обратной транскрипцией (RT-qPCR), гибридизация in situ и транскриптомика (среди прочего), были установлены, но еще не получили широкого применения (Feng et al., 2009; Херлитце и др., 2018). Несколько исследований с использованием RT-qPCR охватывают несколько тем, включая хиральность, обучение и память (Sadamoto et al., 2010; Foster, Lukowiak & Henry, 2015; Davison et al., 2016; Korneev et al., 2018; Dong et al. др., 2018). Кроме того, в небольшом количестве исследований использовалась гибридизация in situ у этого вида, в основном на срезах и целых препаратах ЦНС, а также на личинках (Dirks et al., 1989; Boer et al., 1992; Croll & Van Minnen, 1992; Садамото и др., 2004).Наша цель здесь состоит в том, чтобы продолжить создание основы для дальнейших исследований молекулярной генетики в L. stagnalis путем проверки генов-кандидатов эталонных для RT-qPCR.

    RT-qPCR — это надежный метод количественного определения мРНК для определенного транскрипта. Его можно использовать вместе с гибридизацией in situ или другими методами визуализации для установления закономерностей экспрессии генов у животных. Для таких экспериментов относительная количественная оценка по одному или нескольким эталонным генам является наиболее распространенным выбором для сравнения экспрессии генов в образцах (Schmittgen & Livak, 2008; Ruijter et al., 2009). Исторически так сложилось, что высокоэкспрессированные клеточные поддерживающие гены были случайным образом выбраны в качестве эталонных генов для экспериментов qPCR у многих видов, поскольку считалось, что экспрессия таких генов по своей природе стабильна (Kozera & Rapacz, 2013). Однако было показано, что многие из этих генов имеют нестабильную экспрессию у некоторых видов растений и животных, что подчеркивает важность валидации для конкретных видов перед использованием (Dheda et al., 2004; Barber et al., 2005; De Jonge et al., 2005). и др., 2007; Тонг и др., 2009; Эйсса и др., 2016). Таким образом, проверка того, что эталонные гены-кандидаты имеют стабильную экспрессию, имеет решающее значение для получения точных данных количественной ПЦР и экспериментальных подходов, включающих этот метод.

    Насколько нам известно, единственный предыдущий пример проверки эталонного гена в L. stagnalis относится к EF1α в ЦНС (Foster, Lukowiak & Henry, 2015). В других экспериментах использовались эталонные гены без проверки, включая фактора элонгации 1-альфа ( EF1α) (Gust et al., 2013б; Shimizu et al., 2013), глицеральдегид-3-фосфатдегидрогеназа ( GAPDH ) (Aleksic & Feng, 2012), бета-актин ( ACTB ) (Senatore & Spafford, 2012; Hatakeyama et al. , 2013; Carter et al., 2015) и бета-тубулина ( TUBB ) (Bavan et al., 2012; Корнеев и др., 2013; Gust et al., 2013b; Flynn et al., 2014; Картер и др., 2015; Бенатти и др., 2017). Чтобы заложить более строгую основу для будущих исследований с использованием RT-qPCR, мы представляем анализ семи генов-кандидатов в шести представляющих интерес тканях (щупальца, губы, ступня, пенис, мантия и ЦНС) в L.стагналис . Мы также предоставляем комбинированный анализ данных из всех тканей, чтобы продемонстрировать, какие гены, вероятно, будут наиболее стабильно экспрессироваться в препаратах всего тела L. stagnalis .

    Мы исследовали стабильность Lst-EF1 α, Lst-GAPDH , Lst-ACTB , Lst-TUBB и Lst-убиквитина ( UBI ), поскольку они обычно используются в качестве эталонных генов. Транскрипты матричной РНК, кодирующие пренилированный rab-акцепторный белок 1 ( Rapac1 ) и потенциалзависимый калиевый канал ( VGKC ), также были оценены как аналоги этих генов, недавно было обнаружено, что они стабильны у наземных брюхоногих моллюсков Cepaea nemoralis ( Аффенцеллер, Серво и Джексон, 2018 г.).

    Методы

    Уход за улитками

    Использование животных соответствовало рекомендациям Канадского совета по уходу за животными. Колонию L. stagnalis выращивали и содержали в помещении для ухода за животными StFX. Животные подвергались воздействию фотопериода, соответствующего естественному дневному свету в Антигонише, Новая Шотландия. Воду в аквариумах с животными меняли три раза в неделю. Животных кормили кормом для рыб и салатом ромен вволю, а также тонущими белковыми гранулами один раз в неделю.

    Тотальная экстракция РНК

    Из каждой L. stagnalis интересующей ткани собирали

    тотальной РНК. Для подготовки к выделению РНК животных анестезировали 0,125% 1-фенокси-2-пропанолом, растворенным в физиологическом растворе Lymnaea , на срок до 30 мин (Wyeth et al., 2009). Животных препарировали для выделения шести представляющих интерес тканей: ЦНС, щупалец, губ, полового члена, стопы и мантии. Ткани каждого типа от двух животных объединяли для каждой повторности, чтобы обеспечить адекватный выход РНК из каждой ткани, с помощью этого метода получали три повторности.Ткани быстро замораживали в жидком азоте, измельчали ​​лезвиями бритвы и добавляли к 500 мкл реагента TRIzol (Thermo Fisher, Waltham, MA, USA). Тканевые растворы тщательно гомогенизировали с помощью гомогенизатора тканей PowerGen 125 (Thermo Fisher, Уолтем, Массачусетс, США). Тотальную РНК выделяли из гомогенизированной ткани добавлением 0,5 объема раствора хлороформа и изоамилового спирта, 24:1. Водный слой отделяли и РНК осаждали изопропиловым спиртом. Осадок РНК переносили на спин-колонку E.З.Н.А. ® Mollusc RNA Kit (Omega Bio-Tek, Норкросс, Джорджия, США), где РНК промывали и подвергали обработке ДНКазой I на колонке в соответствии с инструкциями производителя. Для подтверждения эффективности обработки ДНКазой I была проведена ПЦР с наборами праймеров для Lst-тирозингидроксилазы (прямой: 5′-CCCACGTGTATCGTCATCTTA-3′; обратный: 5′-ATCTTCTCCTCGCAAAACC-3′) и Lst-EF1 . α с 20 нг общей РНК в качестве матрицы, так как эта реакция не будет работать в отсутствие загрязнения геномной ДНК (гДНК). Lst-тирозингидроксилаза была выбрана в качестве одного из средств контроля загрязнения гДНК, поскольку мы часто амплифицируем ее во всех интересующих тканях в рамках более крупного исследовательского проекта по развитию нервной системы. После 40 циклов амплификации ни одного гена не наблюдалось ни в одном из образцов РНК, поэтому образцы РНК были сочтены свободными от загрязнения гДНК.

    Тотальной РНК количественно определяли на QuBit 3.0 (Thermo Fisher, Уолтем, Массачусетс, США). Выходы 50–200 нг/мкл, растворенные в 30 мкл воды молекулярной чистоты, были обычными для примерно 40 мг тканевой массы.Образец общей РНК измеряли с помощью спектрофотометра, чтобы подтвердить соотношение 260:280, равное 1,8–2,0. Наконец, пять мкл каждого образца РНК денатурировали в пяти мкл 2× красителя для загрузки РНК (New England Biolabs, Ипсвич, Массачусетс, США) при 75 °C в течение 10 минут, а затем немедленно помещали на лед. Образцы РНК загружали в 1% агарозный неденатурирующий гель и пропускали вместе с одноцепочечной РНК-лестницей (New England Biolabs, Ипсвич, Массачусетс, США), чтобы убедиться, что полосы 28S и 18S рРНК не повреждены, а образцы РНК не повреждены. деградировал.

    ПЦР с обратной транскрипцией

    Обратную транскрипцию-ПЦР проводили с помощью iScript Reverse Transcription Supermix для RT-qPCR (Bio-Rad Laboratories, Геркулес, Калифорния, США), которая содержит смесь олиго(dT) праймеров и случайных гексамеров. Для реакций ОТ-ПЦР 500 нг РНК добавляли к четырем мкл iScript Supermix и доводили до 20 мкл водой молекулярной чистоты в соответствии с рекомендациями производителя. ОТ-ПЦР проводили в термоциклере Bio-Rad CFX Connect (Bio-Rad Laboratories, Геркулес, Калифорния, США).Программа ОТ-ПЦР выполнялась при 25°С в течение 5 мин, 46°С в течение 20 мин и 95°С в течение 1 мин.

    Разработка, проверка и оптимизация праймеров для количественной ПЦР

    Праймеры-кандидаты

    , предназначенные для количественной ПЦР, были разработаны с помощью программного обеспечения CLC Main Workbench (Qiagen, Hilden, Germany). Праймеры были разработаны так, чтобы иметь длину 19–23 нуклеотида, температуру плавления от 55 до 62 ° C, содержание GC от 40% до 60% и давать продукт длиной не более 200 п.н. Кроме того, содержание GC в каждом праймере не превышало 10 % по сравнению с его аналогом, а температура плавления каждого из них поддерживалась в пределах 3 °C по сравнению с его аналогом.

    Для каждого гена было разработано от двух до шести наборов праймеров, чтобы можно было выбрать оптимальные праймеры для реакций количественной ПЦР. Праймеры тестировали на комбинированных образцах кДНК, чтобы свести к минимуму тканеспецифическую погрешность. Были построены кривые плавления, чтобы убедиться, что один продукт амплифицируется. Если праймеры давали один продукт, то пять мкл ПЦР-реакций проводили на 2% (масса/объем) агарозном геле при 60 В в течение примерно 30 минут вместе с цепочкой ДНК 50 п.н. (New England BioLabs, Ипсвич, Массачусетс, США). Агарозные гели анализировали с помощью Bio-Rad ChemiDoc (Bio-Rad Laboratories, Геркулес, Калифорния, США) для визуализации размера продукта.В конце концов, для каждого референсного гена-кандидата был выбран один набор праймеров на основе качества продукта ПЦР. Праймеры для каждого референсного гена-кандидата перечислены в таблице 1.

    Таблица 1:

    Описание всех праймеров, использованных для амплификации референсных генов-кандидатов в Lymnaea stagnalis .

    Праймеры, помеченные «For», являются прямыми праймерами, а праймеры, помеченными «Rev», являются обратными праймерами, все последовательности написаны в направлении от 5′ к 3′. Эффективность амплификации определяли для каждого набора праймеров эталонного гена после RT-qPCR с пятью серийными разведениями 1:5 тотальной РНК из 100 нг.
    Ген Последовательность праймеров (от 5′ до 3′) Функция Размер продукта (бп) Тпл (°С) Эффективность р 2 Присоединение
    Lst-ACTB Для [AGGCCAACAGAGAAAAGA]
    Rev [AGATGCGTACAGAGAGAG]
    Структура клетки и подвижность 97 56 2.12 0,999 KX387883
    Lst EF1α Для [ACCACAACTGGCCACTTGATC]
    Rev [CCATCTCTTGGGCCTCTTTCT]
    Доставка тРНК для синтеза белка 85 59 2,00 0,998 МХ687364
    Lst ГАПДХ Для [CAACAACCGACAAAGCAA]
    Ред. [CATAACAAACATAGGGGCA]
    Углеводный обмен 93 55 1.82 0,988 МХ687363
    Lst Rapac1 Для [GGCTCTTTCTTTCCCTTTGT]
    Rev [TTCCTGCTCTTCTTGCGT]
    Сотовая торговля 124 58 1,82 0,989 МХ687365
    Лст ТУББ Для [GGCTAGGGGATGAAGATGA]
    Rev [AGGATGAGGGTGAATTTGA]
    Элемент микротрубочек — клеточная структура 130 56 1.80 0,993 KX387887
    Лст УБИ Для [GTATTGTGGTGCTGGTGTTTT]
    Rev [GCTTCCTCCTCTGGTTTGT]
    Регулирует функцию белка 105 59 1,94 0,993 МХ687367
    Лст ВГКЦ Для [TGGCTTCCTGCTTCTCTGT]
    Rev [GCTTCTGTCGTTGTTTTTGCT]
    Поддержание потенциала клеточной мембраны 99 60 1.82 0,997 МХ687366
    DOI: 10.7717/peerj.7888/таблица-1

    После выбора оптимальных наборов праймеров на основе специфичности реакции была рассчитана эффективность каждого набора праймеров. Кривые эффективности праймеров были получены из реакций RT-qPCR с серийными разведениями РНК. Исходная реакция содержала 100 нг общей РНК, и были выполнены четыре разведения 1:5 для получения пяти значений Cq.

    Количественная ПЦР

    При сборе данных количественной ПЦР соблюдались минимальные требования к публикации руководящих принципов проведения количественных экспериментов ПЦР в реальном времени (MIQE) (Bustin et al., 2009). Амплификация всех генов была обнаружена с помощью красителя SyBR Green, который генерирует флуоресценцию на основе синтеза двухцепочечной ДНК. Реакции содержали 2 мкл кДНК с 10 мкл Bio-Rad SsoAdvanced Universal SyBR Mix, концентрацию прямого и обратного праймеров 600 нМ и доводили до 20 мкл DEPC H 2 O. Каждый повтор тканей L. stagnalis был подвергали реакциям КПЦР в трех повторностях. Реакции количественной ПЦР проводились в термоциклере Bio-Rad CFX Connect с использованием специальной программы.Пользовательская программа qPCR состояла из 95 ° C в течение 30 с; 40 циклов: 95 °С в течение 15 с, 55 °С в течение 30 с. Планшет считывался машиной для измерения флуоресценции в конце каждого цикла.

    Анализ данных

    Стабильность экспрессии каждого гена оценивали с помощью четырех вычислительных алгоритмов: geNorm (Vandesompele et al., 2002), NormFinder (Andersen, Jensen & Ørntoft, 2004), BestKeeper (Pfaffl et al., 2004) и RefFinder (Xie et al., 2004). др., 2012). GeNorm ранжирует кандидатов по их значениям стабильности экспрессии ( M ), которые присваиваются после парных измерений вариаций между генами.Гены с M < 1,5 считаются стабильными. Алгоритм NormFinder сравнивает внутригрупповую изменчивость (т. е. уровни мРНК одного гена в интересующей ткани) с межгрупповой изменчивостью (т. е. уровни мРНК других генов в тех же тканях) и присваивает генам значение стабильности на основе вариации между Значения CQ. BestKeeper строит индекс стабильности на основе повторяющихся парных корреляционных анализов между каждым эталонным геном и оценивает стабильность эталонного гена на основе стандартного отклонения (SD) от индекса. BestKeeper оценивает гены с меньшим SD более высоко.Наконец, RefFinder использовался для объединения ранжированных результатов каждого алгоритма и присвоения каждому гену общего ранга.

    Были проведены анализы данных для сравнения стабильности референсных генов-кандидатов в каждой интересующей ткани. После тканеспецифического анализа мы также объединили все данные для анализа, чтобы смоделировать условия анализа всего тела. Этот подход позволил определить, какие гены наиболее стабильны в каждой интересующей ткани, и предоставил доказательства того, какие гены будут наиболее сильными эталонными генами в эксперименте RT-qPCR, в котором использовалась РНК из целых л.стагналис кузов. Учитывая, что для надлежащей нормализации данных RT-qPCR обычно рекомендуется минимум два эталонных гена, рекомендуемые эталонные гены обычно выражаются парами.

    Результаты

    Специфичность и эффективность праймеров

    Праймеры для всех референсных генов-кандидатов были оценены, чтобы убедиться, что они могут давать согласованные результаты и не амплифицировать нецелевые продукты или генерировать димеры праймеров. После амплификации каждая пара праймеров продуцировала ампликоны, которые давали одиночные полосы нужного размера после электрофореза в 2% агарозных гелях (рис.1). Кроме того, не наблюдалось амплификации в контрольных образцах, в которых отсутствовала обратная транскриптаза в ОТ-ПЦР или отсутствовала матрица кДНК или праймеры в количественном ПЦР. Таким образом, пары праймеров специфически амплифицируют одну кДНК-мишень. На основании стандартных кривых эффективность набора праймеров варьировалась от 90% ( GAPDH и Rapac1 ) до 106% ( ACTB ) с коэффициентами корреляции ( R 2 ) >0,980 (таблица 1).

    Рисунок 1: Репрезентативное изображение продуктов ПЦР для каждого эталонного гена.
    Пять мкл образца каждого продукта ПЦР анализировали на 2% агарозном геле, который также содержал контроль без праймера (NPC).

    Тканеспецифические профили экспрессии и стабильность эталонных генов

    Референсные гены-кандидаты показали различные уровни экспрессии в отдельных тканях (рис. 2). Lst-UBI давал наименьшие средние значения Cq и отображал наименьшие диапазоны Cq для большинства тканей (таблица 2). Наоборот, мРНК Lst-VGKC была наименее распространена в каждой ткани и демонстрировала большие диапазоны Cq.

    Рисунок 2: Уровни экспрессии для каждого гена в каждой ткани на основе Cq.
    Данные собирали из трех повторностей ткани L. stagnalis , и каждую реакцию проводили в трех повторах. Исследуемые ткани: (A) ЦНС, (B) щупальца, (C) губы, (D) половой член, (E) ступня и (F) мантия. Блочная диаграмма: верхняя и нижняя границы прямоугольника обозначают 25-й и 75-й процентили, линия деления в прямоугольнике указывает медиану, а усы указывают минимальное/максимальное значения. Таблица 2:

    Средние значения Cq и стандартные ошибки среднего (SEM) эталонных генов для тканей в Lymnaea stagnalis .

    Средние значения рассчитывали из трех повторов ткани L. stagnalis , каждую реакцию проводили в трех повторах. Tue
    Lst-ACTB Lst-EF1 α Lst-GAPDH Lst-Rapac1 Лст-ТУББ Лст-УБИ Лст-ВГКЦ
    Cq среднее СЭМ Cq означает СЭМ Cq означает СЭМ Cq означает СЭМ Cq означает СЭМ Cq означает СЭМ Cq означает СЭМ
    ЦНС 19.27 0,67 19,49 0,53 21.10 0,56 26,81 0,81 18.30 0,76 16,72 0,20 29,27 0,82
    Щупальца 17,42 0,20 18.50 0,22 20.14 0,21 27,36 0,43 17,99 0,36 16.41 0,19 28,86 0,23
    Губы 18.19 0,27 19.14 0,23 21.01 0,21 26,97 0,19 18,39 0,29 17.11 0,27 29,26 0,28
    Пенис 18.30 0,38 17,87 0,25 19,71 0.25 26,44 0,35 22.05 1,98 16,55 0,16 30,60 0,23
    Ножка 18.08 0,41 18,91 0,48 20,22 0,46 25,72 0,46 18,53 0,25 16,69 0,24 30,48 0,17
    Мантия 17.67 0,26 18,91 0,24 20.41 0,34 27,57 0,39 22.16 0,42 16,24 0,16 30,78 0,31
    Комбинезон 18.15 0,17 18,80 0,15 20,43 0,16 26,81 0,20 19,57 0,43 16.62 0,09 29,87 0,19
    DOI: 10.7717/peerj.7888/таблица-2

    Алгоритмы, использованные для измерения стабильности каждого референсного гена-кандидата, в высокой степени соответствовали их тканеспецифическим рейтингам. Поэтому на рис. 3 представлены только результаты анализа RefFinder (который объединяет рейтинги трех других алгоритмов) (результаты для других алгоритмов представлены на рис. S1–S3). Lst-GAPDH и Lst-EF1 α были наиболее стабильными референсными генами-кандидатами в ЦНС и половом члене. Lst-UBI и Lst-GAPDH были наиболее стабильны в щупальцах, Lst-GAPDH и Lst-Rapac1 были наиболее стабильны в губах, Lst-UBI и Lst-ACTB были наиболее стабильны в губах. наиболее устойчивы в стопе, а Lst-UBI и Lst-VGKC – в мантии. В целом, идентификация наиболее надежного референсного гена-кандидата зависела от ткани. Однако, согласно geNorm, все гены, за исключением Lst-ACTB и Lst-TUBB , были приемлемы в качестве эталонных генов для всех тканей, поскольку они соответствовали минимальному порогу стабильности M <1.50 для гетерогенных образцов ткани.

    Рисунок 3: Рейтинг RefFinder для всех референсных генов-кандидатов по тканям.
    Рейтинг RefFinder для (A) ЦНС, (B) щупалец, (C) губ, (D) полового члена, (E) стопы и (F) мантии. RefFinder вычисляет рейтинги как среднее геометрическое рейтингов, присвоенных geNorm, NormFinder и BestKeeper. Гены ранжированы в порядке от наименее стабильных к наиболее стабильным на каждой панели.

    Уровни экспрессии и стабильность эталонных генов в комбинированном анализе тканей

    Чтобы оценить, какие референсные гены-кандидаты могут быть наиболее стабильными в препаратах всего тела L.stagnalis данные всех тканей были объединены и проанализированы вместе с geNorm, NormFinder, BestKeeper и RefFinder. Референсные гены-кандидаты охватывают широкий диапазон уровней экспрессии при объединении данных по всем типам тканей. Основываясь на значениях Cq, ген Lst-UBI был наиболее высоко экспрессированным геном (средний Cq 16,62 ± 0,09) и имел наименьший общий диапазон Cq, тогда как ген Lst-VGKC был наименее экспрессированным геном и имел самую высокую биологическую изменчивость по результатам измерений. по стандартной ошибке среднего (среднее Cq 29.87 ± 0,19; Таблица 2). Все четыре алгоритма, использованные для оценки стабильности экспрессии, в высокой степени соответствовали их ранжированию референсных генов-кандидатов в комбинированном анализе (рис. 4). GeNorm, NormFinder и RefFinder оценили Lst-GAPDH и Lst-EF1 α как два наиболее стабильных эталонных гена. BestKeeper оценил Lst-UBI как наиболее стабильный, а Lst-EF1 α и Lst-GAPDH как второй и третий по стабильности соответственно.

    Рисунок 4: Рейтинги комбинированного анализа, присвоенные каждому референтному гену-кандидату.
    Данные по всем тканям были объединены и ранжированы с помощью (A) geNorm, (B) NormFinder, (C) BestKeeper и (D) RefFinder. * Указывает, что оба гена были одинаково рекомендованы.

    Обсуждение

    Мы использовали несколько установленных алгоритмов для анализа данных об изобилии мРНК и идентификации стабильно экспрессируемых генов, которые подходят в качестве эталонных генов для RT-qPCR в L. stagnalis . Мы оценили семь референсных генов-кандидатов ( Lst-ACTB , Lst-EF1 α, Lst-GAPDH , Lst-Rapac1 , Lst-TUBB , Lst-VC , G, в шести представляющих интерес тканях (ЦНС, щупальца, губы, пенис, ступня и мантия) и предоставили отдельный анализ всех объединенных тканей.Среди генов в разных тканях были разные модели стабильности экспрессии, но тканеспецифические рейтинги, полученные с помощью разных алгоритмов, были в высокой степени конгруэнтными. Lst-GAPDH и Lst-EF1 α были наиболее подходящей парой эталонных генов в ЦНС и половом члене. Однако Lst-UBI также был одним из двух наиболее стабильных генов щупалец, стопы и мантии в сочетании с Lst-GAPDH , Lst-ACTB и Lst-VGKC соответственно.Наконец, Lst-GAPDH и Lst-Rapac1 оказались наиболее стабильными в губах. В комбинированном анализе наиболее стабильными генами по всем алгоритмам оказались Lst-GAPDH , Lst-EF1 α и Lst-UBI . Таким образом, для будущих экспериментов с использованием целых животных или тканей или комбинаций тканей, не включенных в наш анализ, мы рекомендуем эти три гена в качестве первых кандидатов для проверки в качестве эталонных генов.

    Предыдущие измерения стабильности эталонного гена RT-qPCR выявили некоторые устойчивые закономерности у моллюсков. EF1α , по-видимому, является наиболее эффективным эталонным геном у нескольких видов моллюсков в дополнение к ЦНС и половому члену L. stagnalis (таблица 3). В одном исследовании L. stagnalis , EF1α было установлено, что он остается стабильным в ЦНС при тепловом стрессе (Foster, Lukowiak & Henry, 2015). Учитывая, что EF1 α также был идентифицирован как высокостабильный у некоторых других моллюсков, он, по-видимому, является надежным референтным геном-кандидатом по всему типу (Morga et al., 2010; Ван и др., 2011; Куберо-Леон и др., 2012 г.; Маурис и др., 2012 г.; Морейра и др., 2014; Гарсия-Фернандес и др., 2016 г.; Хуан, Ван и Лю, 2016 г.). Анализ эталонных генов пресноводной улитки Bellamya aeruginosa показал, что EF1 α и GAPDH были стабильны в щупальцах и пенисе, но более изменчивы в стопе (Liu et al., 2015), как и наши результаты (Liu et al., 2015). хотя и с некоторыми расхождениями в ранжировании по щупальцам и стопе). Также было показано, что GAPDH является стабильным эталонным геном у двустворчатых моллюсков (Morga et al., 2010; Martínez-Escauriaza et al., 2018), но был признан непригодным для морских ушек и осьминогов (Wan et al., 2011; García-Fernández et al., 2016). Таким образом, GAPDH неодинаков для всех моллюсков. Кроме того, GAPDH обладает высокой стабильностью у наземных брюхоногих моллюсков C. nemoralis в течение определенного сезона, но уровни экспрессии у этого вида сильно различаются между сезонами (Affenzeller, Cerveau & Jackson, 2018). По нашим данным, Lst-UBI имел очень стабильный профиль экспрессии между тканями по сравнению с другими эталонными генами, и было обнаружено, что он очень стабилен в стопе, мантии и щупальцах, а также в комбинированном анализе. UBI также показал многообещающие результаты у других моллюсков (Sirakov et al., 2009; García-Fernández et al., 2016; Affenzeller, Cerveau & Jackson, 2018). Альфа-тубулин ( TUBA ) в целом дал положительные результаты в качестве эталонного гена у нескольких видов моллюсков (Sirakov et al., 2009; Cubero-Leon et al., 2012; Moreira et al., 2014). Однако TUBA был нестабилен в C. nemoralis (Affenzeller, Cerveau & Jackson, 2018), и мы также обнаружили, что Lst-TUBB крайне нестабилен. ACTB , как правило, давал отрицательные результаты в качестве референтного гена-кандидата у моллюсков (Cubero-Leon et al., 2012; Moreira et al., 2014; Liu et al., 2015; García-Fernández et al., 2016; Huan, Wang & Liu, 2016), и полученные здесь результаты для L. stagnalis в значительной степени совпадают с этими предыдущими выводами, хотя Lst-ACTB был стабильным именно в стопе. Наконец, Rapac1 и VGKC были идентифицированы как подходящие эталонные гены в C.nemoralis (Affenzeller, Cerveau & Jackson, 2018). Эти гены показали относительную стабильность в нашем анализе мантии и губ, но были относительно нестабильны в других исследованных тканях.

    Таблица 3:

    Резюме рейтингов стабильности эталонных генов из исследований, проведенных на моллюсках.

    Организм Самый стабильный ген(ы) Наименее стабильный ген(ы) Другие протестированные гены Артикул
    Брюхоногие моллюски
    Галиотис дискус EF1 α/ RPL5 18S рРНК ACTB , BGLU , CY , CY , GAPDH , HPRT , HPRT , SDHA , TUBB , UBC , CYP4 Ван и др.(2011)
    Bellamya aeruginosa РПЛ7 АКТВ 18S рРНК , EF1α , GAPDH , TUBB , h3A , DRP2 Лю и др. (2016)
    Cepaea nemoralis EF1α/ACTB ГАПДХ ДНАРП , ФИБ3 , ГТП8 , Рапак1 , РНКП , ТУБА , УБИ , ВГК4 Аффенцеллер, Серво и Джексон (2018)
    Lymnaea stagnalis EF1α/GAPDH АКТБ/ТУББ ВГКЦ , УБИ , Рапак1 Настоящее исследование
    Головоногие
    Осьминог обыкновенный ТУБА/УБИ 18S рРНК 16S рРНК , ACTB , EF1α , TUBA Сираков и др.(2009)
    Осьминог обыкновенный УБИ АКТВ 18S рРНК , EF1α , GAPDH , TUBA Гарсия-Фернандес и др. (2016)
    Двустворчатые моллюски
    Ostrea edulis EF1α/GAPDH АКТВ УБИ, РПЛ5 Морга и др.(2010)
    Mytilus edulis EF1α/18S рРНК АКТВ 28S рРНК , TUBA , HEL Куберо-Леон и др. (2012)
    Mytilus galloprovincialis EF1α АКТВ 18S рРНК , ТУБА Морейра и др. (2014)
    Рудитапес филиппинарум ТУБА АКТВ 18S рРНК , EF1α Морейра и др.(2014)
    Crassostrea gigas EF1α РПС18 АКТБ , АРФ1 , ГАПДХ , ХНРПК , УБК Хуан, Ван и Лю (2016)
    Mytilus galloprovincialis ГАПДХ/РПС4 НАД4/18S рРНК АКТБ , КОКС1 , ГАПДХ , РПС27 , ТИФ5А Мартинес-Эскауриаза и др.(2018)
    DOI: 10.7717/peerj.7888/таблица-3

    Несмотря на неоднородность референсных генов высшего ранга в тканях, наблюдалась некоторая согласованность в стабильности экспрессии во всех тканях. Хотя Lst-EF1 α, Lst-GAPDH и Lst-UBI не были лучшими в каждой ткани по оценке RefFinder, они были относительно стабильны во всех протестированных тканях, что отражено в значениях стабильности, представленных генорм. Таким образом, мы рекомендуем эти гены для использования в сравнениях нескольких тканей у L.стагналис . В частности, Lst-EF1 α и Lst-GAPDH представляют собой благоприятную пару, так как имеют наиболее близкие диапазоны Cq. Важно отметить, что, несмотря на продемонстрированную здесь стабильность этих генов в исходных условиях, было бы крайне важно напрямую проверить их стабильность в любых экспериментальных условиях (Kozera & Rapacz, 2013).

    Заключение

    Валидация стабильных эталонных генов необходима для получения надежных данных об экспрессии генов.Поэтому важно выполнить видоспецифическую проверку стабильности эталонного гена перед проведением экспериментов RT-qPCR. Вариабельная экспрессия семи генов среди шести типов тканей, которые мы исследовали в L. stagnalis , демонстрирует, что очень важно выбирать эталонные гены на основе интересующих тканей. Представленные здесь результаты должны помочь в выборе эталонных генов для тканеспецифичной RT-qPCR и тем самым помочь в будущих исследованиях экспрессии генов у улиток.

    Дополнительная информация

    Рейтинги стабильности

    GeNorm для всех референсных генов-кандидатов в каждой ткани.

    гена ранжированы в порядке от наименее стабильного до двух наиболее стабильных.

    DOI: 10.7717/peerj.7888/supp-1 Рейтинги стабильности

    NormFinder для всех референсных генов-кандидатов в каждой ткани.

    гена ранжированы в порядке от наименее стабильного к наиболее стабильному.

    DOI: 10.7717/peerj.7888/supp-2

    рейтингов стабильности BestKeeper для всех эталонных кандидатов в каждой ткани.

    гена ранжированы в порядке от наименее стабильного к наиболее стабильному.

    DOI: 10.7717/peerj.7888/supp-3

    Необработанные значения Cq для всех реакций количественной ПЦР.

    Реакции проводили в трех повторностях для каждого гена и каждой ткани. Для этого набора данных 500 нг РНК использовали в реакции обратной транскрипции перед количественной ПЦР.

    DOI: 10.7717/peerj.7888/supp-4

    Все значения Cq для реакций количественной ПЦР.

    Это дополнительный набор данных, не упомянутый в текущей версии статьи.Все необработанные значения Cq для каждой реакции количественной ПЦР. Реакции проводили в трех повторностях для каждого гена и каждой ткани. Для этого набора данных 20 нг РНК использовали в реакции обратной транскрипции перед количественной ПЦР.

    DOI: 10.7717/peerj.7888/supp-5

    Пламя невежества и мудрость улитки

    Сила улитки

    После блуждания по инкубатору «Школы майяского продовольственного леса» в Чьяпасе в части I и наблюдения за сопротивлением первых народов юга Мексики могущественным корпоративным и правительственным силам, намеревающимся уничтожить их автономию и культуру в части II, мы заканчиваем взглядом. Назад к прошлому чудесному и постыдному и к будущему, вырезанному на раковине улитки.

    «Рацион местных жителей до испанского завоевания состоял не только из кукурузы и бобов», — объясняет Пако Васкес, координатор Prodmedios, медиа-компании из Сан-Кристобаля, которая помогает местным сообществам по всей Мексике рассказывать свои собственные истории. с использованием самых разных средств массовой информации. Выросший на окраине того, что когда-то было столицей ацтеков, Пако является прямым потомком водных архитекторов науатль, которые построили плавучие сады и аквакультуру, которыми восхищались испанцы, а затем уничтожили.Пять веков превратили город, когда-то пронизанный чистыми каналами, в мегаполис, задыхающийся от дизельного топлива; так что Пако что-то знает об утерянных знаниях.

    Ботаника майя. Детский шалфей – эффективный местный антисептик.
    (Фото: Нэт Кригер)

    «Астрономы майя рассчитали Большой взрыв, это их самое большое число. Они использовали основание 20; столькому испанцы могли бы поучиться. Майя также знали об устойчивости. Система энкомьенд уничтожила пищевые леса.Ограничившись одной усадьбой , у людей не осталось ни времени, ни сил даже на то, чтобы добраться до леса. Люди здесь доведены до нищеты колониальной системой, раньше они не были бедны».

    Будь то порабощение и насильственное обращение при испанцах и их мексиканских преемниках, или ассимиляционные программы развития середины двадцатого века, направленные на исчезновение коренных народов в той или иной версии национальной культуры, большая материальная нищета всегда сопровождалась усилиями по деградации или уничтожить местные источники знаний и самоуважения.

    «Люди, — вздыхает Армандо, — забыли о своих богатствах».

    История усеяна преднамеренным уничтожением человеческих знаний: от сожжения, фактически сожжения библиотек Александрии до уничтожения Исламским государством 700-летних рукописей в Тимбукту; от ритуальных жертвоприношений Талмуда на улицах средневекового Парижа до зажигательных снарядов, выпущенных сербской националистической артиллерией, которые сожгли Сараевскую библиотеку изнутри. Заметное место в этом прискорбном списке занимает сожжение инквизицией тысяч кодексов майя, в том числе очень публичные костры, зажженные самим архиепископом.Если семь сохранившихся пьес Софокла напоминают нам о 116, которых у нас нет, то четыре кодекса майя, избежавшие огня, лишь заставляют нас удивляться знаниям — астрономическим, математическим, социальным и, да, ботаническим, — которых у нас никогда не будет. опять таки.

    Народы майя, претендующие на свою культуру, языки и потоки знаний. Посторонний, пытающийся понять, насколько это революционно для Чьяпаса, должен сначала понять, как долго ладино (как в Чьяпасе традиционно называют более светлокожих, некоренных говорящих на испанском языке) думали и, следовательно, относились к майя штата. большинство как недочеловеки.

    Поэт из Чьяпаса, писательница и феминистка Росарио Кастелланос запечатлела это отношение в своей ужасающей и вечной Книге Плача . Назначенный в Сан-Хуан-Чамула, цоцильскую деревню недалеко от Сан-Кристобаля, отец Мануэль смотрит на ризничего, человека, который заботился о маленькой церкви после смерти бывшего священника. Смотритель говорит на языке, которого священник не понимает, и имеет мировоззрение, которое падре не может понять:

    «Каждое неуклюжее движение Ксо раздражало его.Индейский зверь, повторял он про себя, индейский зверь, жалкий индеец. И подумать только, что есть кто-то, кто хочет считать тебя человеком!»

    Кадры из Чьяпаса из ее детства 1930-х годов, которые Кастелланос никогда не забывал: мужчины цоциль со стульями, привязанными к их спинам, несут ладино — детей и взрослых — по улицам Сан-Кристобаля. Иногда белые ездили на них в течение нескольких дней в загородные поместья в горах, и этот способ передвижения продолжался, по крайней мере, еще одно поколение.

    «Я метис, но мне тоже пришлось сойти с тротуара», — добавляет Армандо. «Вплоть до 1970-х тротуары были для богатых».

    «Как узнать, кто был богат?»

    «Одежда и более светлая кожа».

    Как и у многих уроженцев Чьяпаса, жизнь Армандо была построена на взаимодействии мира природы с миром машин, зова земли и возможностей в далеких городах. Сейчас ему 59 лет, он вырос в доме, наполненном звуками ткачества.В детстве Армандо помогал своим бабушке и дедушке с их 15 ткацкими станками и деревянными емкостями с краской. Он помнит, как женщины украшали свои черные юбки до щиколотки разноцветными полосками, которые обозначали их деревню. Для одной группы его бабушка и дедушка красили и пришивали толстую небесно-голубую полосу, опоясывающую низ юбки, а в другой деревне была более тонкая темно-синяя полоса.

    Первой любовью Армандо были растения, семейное поле было всего в полукилометре от него, но рано он понял, что умеет обращаться с машинами.Когда он был еще маленьким, Армандо собрал небольшую четырехколесную повозку, на которую он свалил влажную золу, которая использовалась в качестве ингредиента в процессе производства красок, а затем разбрасывал ее по семейному полю в качестве удобрения. Его carreta было большим улучшением по сравнению с двумя тяжелыми сумками, наполненными промокшими вещами, привязанными к концам шеста, балансирующего на его плечах и шее!

    В молодости Армандо отправился в Мехико, где прошел обучение на GM. механиком, позже вернувшись домой в Чьяпас, чтобы обучать ремеслу молодых людей.(Другие источники добавляют, что, как и старые деревенские врачи, Армандо вернул множество транспортных средств с грани смерти по всей стране сапатистов).

    Два года назад Арман решил посвятить все свое время лесу с едой. «Я отверг свою вторую любовь, — говорит он с легким смехом.

    Кажется, он не жалеет об этом. Вы слышите его любовь к земле в его увлечении окружающими его растениями, вы видите это в том, как его руки держат и просеивают почву, как он останавливается на полуслове, чтобы проследить крылатую формацию.

    Caracol в переводе с испанского означает улитка. Сапатисты выбрали это животное в качестве названия для своих автономных зон, потому что, по словам Армандо, «улитка медленная, но устойчивая». Улитка символизирует сообщество, а также настойчивость — когда улитки получают шанс, они всегда предпочитают быть вместе. Питание мокрыми листьями, грибками и даже грязевыми улитками является важным звеном в естественной цепи разложения. Питая как почву, так и хищников кальцием выживших раковин, эти моллюски обычно изображаются в нижней части пищевой цепи, намного ниже орла или змеи, двух национальных тотемов У.С. и Мексика.

    Медленная, но неуклонная улитка несет один мир, в котором много миров
    (Фото: Нэт Кригер)

    Как и растения, улитки живут как на земле, так и в ней. Оболочка, которую они несут, украшена золотым сечением, спиралью, которая формирует подсолнухи, ураганы, закручивающуюся волну и нашу галактику. Молодые листья кукурузы и человеческие отпечатки пальцев также имеют ту же спиральную структуру. Почти как улитки — это медленно движущиеся рекламные щиты, рекламирующие на языке космической геометрии, который мы слишком «развиты», чтобы понять.

    Сапатисты отвернулись от вооруженной борьбы к более тяжелым, медленным, но более устойчивым усилиям по построению более справедливого общества, всегда начиная с изучения самих себя и своих собственных взглядов. В отличие от многих прошлых революционных сражений, методы соответствуют целям, на самом деле они неразделимы.

    Задержитесь слишком долго в нашем круглосуточно работающем СМИ развлекательном центре эгоизма, эксгибиционизма и демонстративной жестокости, и станет трудно вспомнить, не говоря уже о том, чтобы услышать, сообщения о достоинстве и настойчивости.Но выйдите наружу, в сумерки, и почувствуйте их под ногами, услышите, как их несет ветер. Мы могли бы сделать хуже, чем слушать.

    Для тех, кто хочет помочь проекту Food Forest или узнать о других программах, спонсируемых Schools for Chiapas, перейдите по ссылкам здесь и здесь.

    [Обновлено 2108-07-18] Сразу после того, как этот репортер уехал из Чьяпаса, Армандо, который так много сделал для запуска программы продовольственных лесов, перенес обширный инсульт. Читатели, желающие помочь, могут перейти на страницу GoFundMe или на эту страницу в Facebook .

    Нэт Кригер

    Нэт Кригер работает в Объединенном Сан-Диего, где в хорошие дни он чинит компьютеры.

    Добавить комментарий

    Ваш адрес email не будет опубликован.